ORFeome > soat2 ORF1 – XORFeome v1.0

soat2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: soat2
Gene ID: 961306
Gene Page ID: 961302
ORF Xenbase ID: 17298153

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123338
Original XGC clone length: 1599

Human orthology & disease relationships

NCBI Entrez ID: 8435
Ensembl gene IDs: ENSG00000167780
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 238600,609812

Library Location

Plate ID: GDExl11083
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ837453
dbEST ID: 79655155
Trimmed Sequence: ATGGCCCCAGTGGAGGAGAACGAGGAAGGCTCGTTGAGGCAAAGGAAGAACCATTACCCACAGGAAGCAGCTTGCAATGGAAAAGCAGGTGGTCTGTCTGATAGCAATGGCATCAATGGTCTTATTGAATGGAAGAGACATATGGAGGGGGTAAAGGCTGAACTGGTAGAAGAAATGAGCTGCCACCTGAAAGATCTCCTTGATAAAGCTGTAGCAGAAGCTATATGTTCACACAAAAGAGACCAAGCCTCCATCTTGTCCTCAAAAAAAGACCATGTTAATAATAAAAGGCACAAAGGATCAATTTCGGAAAAGCAAAAAGTATTTATGCATCGTGCTTCACTGTTGGATGATCTGATGGAGGTGGAGCATTTCCGCACTATTTATCACATGTTTGTGGCTGTACTTTGTGTTTTCGTTATCAGCACTGCAGCTGTGGACATCATTGACCAGGGCAGACTGTTTCTGGATCTTGACCTTTTGTTCTACACCTTTGGCCAACTTAGCACTGTGGTATGGACATGGCTCTGTCTATTTATGTATGCACTCCTAGTTCCCTACAGAGCTTTACATGTTTTAGGATCTTTGTACCCAGAATCAGACCATACATTGCTGCTCTCTGCTGTAATAGGAGGTCTGCTGCTTGTCTGCCAAATATCTTGTTCTTGGTGTCCTGCCAATATATGTTGTGACACAGTACAAGCTGCCTCCGCCATCCGCCTTTATGTTAACCTTTGAACCGGGTTCGTTTTTCGGATGAAGAGCTACTCCTTTTTTTAAAAAAATTTGCCTCCCCTGGGGCCGTGAAAAAAGGAAAAAGA
Full Trace Sequence: GGGGGGCCCATATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCCCAGTGGAGGAGAACGAGGAAGGCTCGTTGAGGCAAAGGAAGAACCATTACCCACAGGAAGCAGCTTGCAATGGAAAAGCAGGTGGTCTGTCTGATAGCAATGGCATCAATGGTCTTATTGAATGGAAGAGACATATGGAGGGGGTAAAGGCTGAACTGGTAGAAGAAATGAGCTGCCACCTGAAAGATCTCCTTGATAAAGCTGTAGCAGAAGCTATATGTTCACACAAAAGAGACCAAGCCTCCATCTTGTCCTCAAAAAAAGACCATGTTAATAATAAAAGGCACAAAGGATCAATTTCGGAAAAGCAAAAAGTATTTATGCATCGTGCTTCACTGTTGGATGATCTGATGGAGGTGGAGCATTTCCGCACTATTTATCACATGTTTGTGGCTGTACTTTGTGTTTTCGTTATCAGCACTGCAGCTGTGGACATCATTGACCAGGGCAGACTGTTTCTGGATCTTGACCTTTTGTTCTACACCTTTGGCCAACTTAGCACTGTGGTATGGACATGGCTCTGTCTATTTATGTATGCACTCCTAGTTCCCTACAGAGCTTTACATGTTTTAGGATCTTTGTACCCAGAATCAGACCATACATTGCTGCTCTCTGCTGTAATAGGAGGTCTGCTGCTTGTCTGCCAAATATCTTGTTCTTGGTGTCCTGCCAATATATGTTGTGACACAGTACAAGCTGCCTCCGCCATCCGCCTTTATGTTAACCTTTGAACCGGGTTCGTTTTTCGGATGAAGAGCTACTCCTTTTTTTAAAAAAATTTGCCTCCCCTGGGGCCGTGAAAAAAGGAAAAAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCCCAGTGGAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837452
dbEST ID: 79655154
Trimmed Sequence: TGTGCGACAGGACCAGGATCGAGGAGTTACCAATCCCCAAAAGGTTTTCTCAGTGAGAGGGCAGTGAATCTGAGCATACCACTCCTGGGAGTACAGGCACAGCTGGATGCCTTGACCAATGAACAGGAAAGTCCAAACCATCACGTTCCAAACAGGGCTTTTGCGTTTATCATTCATCATAAAATTAAAGAGGACTCCAAATATGGCAAATAAGCAAAACATGACAGGGTAGAAGTAGCGGAGAGACAGTGTAAAGACGTATTCATGAACTGAGGCAGAGATGAGAAACACCGTCAGCATGACCCCAGCACGGTACCGCTGCTTACACAACGAAAGCAGGTCTTGATATACATAGTAATACAGCCAGTCATGTACAACAACATTCCATGTGCGATAGTAATTTGAAAATGATGTTGAATTCCACCAGTCCTTGTAAAACATACAATCACCAAAACGAAGCATCTCTGCAAAGGCGTTCAACCAGCAATGCAGGAAGGCAAAAAACGACAGCAAAACCACAAATGTACCTGGAAGAATAAGCGTGGAAAAATGACAGTACCACCGTCTTACTGCTAAATGGCTCTTTGCTCATGTTGGTGAAGAACTGGAATGCACGGGGTGAAAAAAAAAAAATTAACCCAAAAAACAAAATATCCAAGAATTTAAGCCACGGTTTGTTGCCCCAAATTTCCCTCTTAATCCATTGGGGTTTCTGGGGAGAAGCTTGGCGGTAGTAATTGGAAAATTTTGACACCCAAAAAAGGAAGAAAGAGAAAAAAAGAC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTGCGACAGGACCAGGATCGAGGAGTTACCAATCCCCAAAAGGTTTTCTCAGTGAGAGGGCAGTGAATCTGAGCATACCACTCCTGGGAGTACAGGCACAGCTGGATGCCTTGACCAATGAACAGGAAAGTCCAAACCATCACGTTCCAAACAGGGCTTTTGCGTTTATCATTCATCATAAAATTAAAGAGGACTCCAAATATGGCAAATAAGCAAAACATGACAGGGTAGAAGTAGCGGAGAGACAGTGTAAAGACGTATTCATGAACTGAGGCAGAGATGAGAAACACCGTCAGCATGACCCCAGCACGGTACCGCTGCTTACACAACGAAAGCAGGTCTTGATATACATAGTAATACAGCCAGTCATGTACAACAACATTCCATGTGCGATAGTAATTTGAAAATGATGTTGAATTCCACCAGTCCTTGTAAAACATACAATCACCAAAACGAAGCATCTCTGCAAAGGCGTTCAACCAGCAATGCAGGAAGGCAAAAAACGACAGCAAAACCACAAATGTACCTGGAAGAATAAGCGTGGAAAAATGACAGTACCACCGTCTTACTGCTAAATGGCTCTTTGCTCATGTTGGTGAAGAACTGGAATGCACGGGGTGAAAAAAAAAAAATTAACCCAAAAAACAAAATATCCAAGAATTTAAGCCACGGTTTGTTGCCCCAAATTTCCCTCTTAATCCATTGGGGTTTCTGGGGAGAAGCTTGGCGGTAGTAATTGGAAAATTTTGACACCCAAAAAAGGAAGAAAGAGAAAAAAAGAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTGCGACAGGACCAGGA