ORFeome > sox17a ORF1 – XORFeome v1.0

sox17a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sox17a
Gene ID: 6255435
Gene Page ID: 484294
ORF Xenbase ID: 17298219

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060350
Original XGC clone length: 1134

Human orthology & disease relationships

NCBI Entrez ID: 64321
Ensembl gene IDs: ENSG00000164736
Directly associated (OMIM) disease MIM numbers: 613674
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11023
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ824925
dbEST ID: 79642627
Trimmed Sequence: ATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTACAGAAGCAAAGCCGAAACTCGGATCCGCCGACCTATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAGGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCGCTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCACATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGCAGATCCTGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACNACTCCAGCTACACTCACCAGCACAACTCTGGNCGCCTCTATGTTGGGTAAGGGCAATGCCACAAACTGTAGCAATAGGTCCAAGGCAGTTCAGTTGGGAGGGGTATGAATG
Full Trace Sequence: ATTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTACAGAAGCAAAGCCGAAACTCGGATCCGCCGACCTATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAGGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCGCTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCACATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGCAGATCCTGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACNACTCCAGCTACACTCACCAGCACAACTCTGGNCGCCTCTATGTTGGGTAAGGGCAATGCCACAAACTGTAGCAATAGGTCCAAGGCAGTTCAGTTGGGAGGGGTATGAATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCAGCCCTGATGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ830293
dbEST ID: 79647995
Trimmed Sequence: GGCACTGGGGTAGTTGCAGTAATATACAGCAGTAGTGGCATCGGAAAGGACAGAAGAGATGGGCCCATTGTCTGCAGTTGGCACCACTGATTCCTGCCCGTGGTAATGCATGCCCAGGTCTGACTTAGACACATAGCTGAGATACTGCTCGAATTCAGTCCTGTCCTCTGCCATCATGTCAGCCTGTTGGGTTTGATCTGCTCTGCCCAACTGCTGAGCCTCGGGGGGAGGGGAAGGCTGCCCAGCCTGGGGGTGCTGGTGATGCCTGGTAGAGCCTGGCAGGTACATCTGTCCATAGTACATGTGTGGGGAGCTCTGGCATGCCATCATACCCTCCACTGGACTGCCTTGACCTATTTGCTCAGTTTGTGGCATTTGCCTTACCAACATAGAGGCGCCAGAGTTGTGCTGGTGAGTGTAGCTGGAGTTGTAGCTGTAGGGCATCATCTGGCACTCGTCCTGGGCTGGAGATGTGAAGAACACAGGATCTGCCTCAGCCAAATCCAGAGGGGAGCTCTCAGGAGTGGGTAAACTGTACCCATCATAATGTGGAGCCATGGCTTGGGGTTCCCTGTAGTGGCTGGCCTGGGGAAGCTGGGGGTAAGTCTGCTCATGGAAACCCAAGTTTGAAGTTCTCCAGGCACATCCTTTCCTCAGCGCCCATAACTGCGCCTCTCCTGCGCCCTCTGTCATGGGGCAGGAAAGCCGTTCTTCTGCCCCTCCTCCATCCCTCCTTCTCCCCGGTTTTCCCCCCTGGCGGGGGGTTTGT
Full Trace Sequence: TGACAGGTAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCACTGGGGTAGTTGCAGTAATATACAGCAGTAGTGGCATCGGAAAGGACAGAAGAGATGGGCCCATTGTCTGCAGTTGGCACCACTGATTCCTGCCCGTGGTAATGCATGCCCAGGTCTGACTTAGACACATAGCTGAGATACTGCTCGAATTCAGTCCTGTCCTCTGCCATCATGTCAGCCTGTTGGGTTTGATCTGCTCTGCCCAACTGCTGAGCCTCGGGGGGAGGGGAAGGCTGCCCAGCCTGGGGGTGCTGGTGATGCCTGGTAGAGCCTGGCAGGTACATCTGTCCATAGTACATGTGTGGGGAGCTCTGGCATGCCATCATACCCTCCACTGGACTGCCTTGACCTATTTGCTCAGTTTGTGGCATTTGCCTTACCAACATAGAGGCGCCAGAGTTGTGCTGGTGAGTGTAGCTGGAGTTGTAGCTGTAGGGCATCATCTGGCACTCGTCCTGGGCTGGAGATGTGAAGAACACAGGATCTGCCTCAGCCAAATCCAGAGGGGAGCTCTCAGGAGTGGGTAAACTGTACCCATCATAATGTGGAGCCATGGCTTGGGGTTCCCTGTAGTGGCTGGCCTGGGGAAGCTGGGGGTAAGTCTGCTCATGGAAACCCAAGTTTGAAGTTCTCCAGGCACATCCTTTCCTCAGCGCCCATAACTGCGCCTCTCCTGCGCCCTCTGTCATGGGGCAGGAAAGCCGTTCTTCTGCCCCTCCTCCATCCCTCCTTCTCCCCGGTTTTCCCCCCTGGCGGGGGGTTTGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCACTGGGGTAGTTGCAGTA