ORFeome > spata2 ORF1 – XORFeome v1.0

spata2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: spata2
Gene ID: 1000072
Gene Page ID: 1000067
ORF Xenbase ID: 17298333

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054226
Original XGC clone length: 690

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ839258
dbEST ID: 79656960
Trimmed Sequence: ATGGATACAAAGTACAAGGAAGACCTCTTTAGAAAATATGTACAGTACCACGAGGCCAAACTGGATGCGCCTGACAACAAGCAGCGTACGGTCAGCGACGAGTATCTTCGCACGGCGGCGTCGGCCTTTCTCAGCCTCCCAAAAGTCGATCCCCTTTATCGATTCCGGCTGATCCGATTCTACGAAGTTTGTGAGAATTCCCTGAAGTCGCTGGTGACTTCGAACCTACGTTCTCTGCACAATGCGGCCGCCATGCTTGAAACAATTGGGATTAACCTCTTCCTGTATCCCTGGAAAAAGGAGTATAAAAGTATAAAGACATACACGGGTCCATTTGTATATTATGTAAGAGCTGCACTTACTGATGATGACATCAGGCATATTTTGCATAATATGGGTTATGTCCAAGAGCTTGGGCCAGTGTACAGGCTGAAAGACCATGTGGACACCACACAAGTTAAGAAAGTTGCCTTTGAACTTTTCTTGGCGAGGGTTGAATGTGAACTGCTGCTAGAAATCTACTTACAAGTCAAGGACAGAGGCTACCTAGAAGTCGACGTCGTTAACGAAAGAAGGAACAGCAACGAGGACGTTCGGGGTTGCACGGACGAAATGAAGAGGAGGGCCGAGTGCAAGGAAACTTTAAATATATCTATGGCAAGGATGGTTCTTCAGAAATCTTGCCAGTT
Full Trace Sequence: GGGGCGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATACAAAGTACAAGGAAGACCTCTTTAGAAAATATGTACAGTACCACGAGGCCAAACTGGATGCGCCTGACAACAAGCAGCGTACGGTCAGCGACGAGTATCTTCGCACGGCGGCGTCGGCCTTTCTCAGCCTCCCAAAAGTCGATCCCCTTTATCGATTCCGGCTGATCCGATTCTACGAAGTTTGTGAGAATTCCCTGAAGTCGCTGGTGACTTCGAACCTACGTTCTCTGCACAATGCGGCCGCCATGCTTGAAACAATTGGGATTAACCTCTTCCTGTATCCCTGGAAAAAGGAGTATAAAAGTATAAAGACATACACGGGTCCATTTGTATATTATGTAAGAGCTGCACTTACTGATGATGACATCAGGCATATTTTGCATAATATGGGTTATGTCCAAGAGCTTGGGCCAGTGTACAGGCTGAAAGACCATGTGGACACCACACAAGTTAAGAAAGTTGCCTTTGAACTTTTCTTGGCGAGGGTTGAATGTGAACTGCTGCTAGAAATCTACTTACAAGTCAAGGACAGAGGCTACCTAGAAGTCGACGTCGTTAACGAAAGAAGGAACAGCAACGAGGACGTTCGGGGTTGCACGGACGAAATGAAGAGGAGGGCCGAGTGCAAGGAAACTTTAAATATATCTATGGCAAGGATGGTTCTTCAGAAATCTTGCCAGTTGCCAACTTTTCTTGTACAAAGTTTGGCATTAATTAAGAAAGCATTGTCTTATCAATTTTTTTGCCAACGAAACAAGGTCCATTTTCAATTTCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATACAAAGTACAAGGAAGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839257
dbEST ID: 79656959
Trimmed Sequence: CTGGCAGATTTCTGAAGAACCATCCTTGCCATAGATATATTTAAAGTTTCCTTGCACTCGGCCCTCCTCTTCATTTCGTCCGTGCAACCCCGAACGTCCTCGTTGCTGTTCCTTCTTTCGTTAACGACGTCGACTTCTAGGTAGCCTCTGTCCTTGACTTGTAAGTAGATTTCTAGCAGCAGTTCACATTCAACCCTCGCCAAGAAAAGTTCAAAGGCAACTTTCTTAACTTGTGTGGTGTCCACATGGTCTTTCAGCCTGTACACTGGCCCAAGCTCTTGGACATAACCCATATTATGCAAAATATGCCTGATGTCATCATCAGTAAGTGCAGCTCTTACATAATATACAAATGGACCCGTGTATGTCTTTATACTTTTATACTCCTTTTTCCAGGGATACAGGAAGAGGTTAATCCCAATTGTTTCAAGCATGGCGGCCGCATTGTGCAGAGAACGTAGGTTCGAAGTCACCAGCGACTTCAGGGAATTCTCACAAACTTCGTAGAATCGGATCAGCCGGAATCGATAAAGGGGATCGACTTTTGGGAGGCTGAGAAAGGCCGACGCCGCCGTGCGAAGATACTCGTCCCTAACCGTACCCTGCCTGTTGTCAGGCGCATCCCGTTTTGCCCTCCTGGTACTGTACATATTTTTCCAAAAAAAGTCTTTCCTTGTACTTTTGGTATCCTTGGTTCCCAAACTTTTTTTGAACAAAGTTTGGGATTTATAAAAAAAGGCATTGGCTCCTTCCTTTTTAAAATAAAAAAAAAAA
Full Trace Sequence: GGCAATCGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGCAGATTTCTGAAGAACCATCCTTGCCATAGATATATTTAAAGTTTCCTTGCACTCGGCCCTCCTCTTCATTTCGTCCGTGCAACCCCGAACGTCCTCGTTGCTGTTCCTTCTTTCGTTAACGACGTCGACTTCTAGGTAGCCTCTGTCCTTGACTTGTAAGTAGATTTCTAGCAGCAGTTCACATTCAACCCTCGCCAAGAAAAGTTCAAAGGCAACTTTCTTAACTTGTGTGGTGTCCACATGGTCTTTCAGCCTGTACACTGGCCCAAGCTCTTGGACATAACCCATATTATGCAAAATATGCCTGATGTCATCATCAGTAAGTGCAGCTCTTACATAATATACAAATGGACCCGTGTATGTCTTTATACTTTTATACTCCTTTTTCCAGGGATACAGGAAGAGGTTAATCCCAATTGTTTCAAGCATGGCGGCCGCATTGTGCAGAGAACGTAGGTTCGAAGTCACCAGCGACTTCAGGGAATTCTCACAAACTTCGTAGAATCGGATCAGCCGGAATCGATAAAGGGGATCGACTTTTGGGAGGCTGAGAAAGGCCGACGCCGCCGTGCGAAGATACTCGTCCCTAACCGTACCCTGCCTGTTGTCAGGCGCATCCCGTTTTGCCCTCCTGGTACTGTACATATTTTTCCAAAAAAAGTCTTTCCTTGTACTTTTGGTATCCTTGGTTCCCAAACTTTTTTTGAACAAAGTTTGGGATTTATAAAAAAAGGCATTGGCTCCTTCCTTTTTAAAATAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGCAGATTTCTGAAGAAC