ORFeome > spdyc ORF2 – XORFeome v1.0

spdyc ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: spdyc
Gene ID: 5886179
Gene Page ID: 5886094
ORF Xenbase ID: 17298387

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123293
Original XGC clone length: 897

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ837522
dbEST ID: 79655224
Trimmed Sequence: ATGAGGCATATGCAGAGTGCAACCCGGGCCACCTTAGTTTGTGGCAGCGGGGTAAAGCAGATCATTGCCAAGGGACATCCGAATACCCGGGTTTTTGGAGCGCGCAAGGCGCGAATCCCTGAGAGAGAGGTGCTAGCAGCCAAACCCAAGATCACGCGCATTACACATCTCAATCTACAACCCCAGGAGCGCCAGGCCTTTTACAGGCTCCTAGAAAATGAGCTGATTCAGGAATTTCTTTCTATGGACTCCTGTCTAAAGATTTCAGACAAGTATCTCATAGCAATGGTTCTAGCATATTTTAAGCGGGCAGGCCTCTACACCGGCGAGTACACAACCATGAATTTCTTTGTTGCTCTGTATCTGGCTAATGACATGGAGGAAGATGAAGAAGACTATAAATATGAAATCTTCCCCTGGGCACTAGGAGATTCATGGCGTGAGTTTTTCCCACAATTTTTACGTCTCCGGGACAACTTCTGGGCTAAAATGAACTACCGAGCAGTTGTTAGCCGAAGATGTTGTGATGAGGTAATGGCGAAAGATCCCACTCATTGGGCCTGGCTCAGAGATCGTCCTATTCATCATAGTGGGGCCCTGCGTGGTTACCTCACAGATGAGGATGACTTTTTCCCTCGGGGTCCAGGCCTTACACCAACCCAGCTGTGCACTTTGCCCTAAAGCAAGTGTCTGTGACTCTGGTGGGGGTCGC
Full Trace Sequence: CGGGGGCCCAATAANTGATGTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGCATATGCAGAGTGCAACCCGGGCCACCTTAGTTTGTGGCAGCGGGGTAAAGCAGATCATTGCCAAGGGACATCCGAATACCCGGGTTTTTGGAGCGCGCAAGGCGCGAATCCCTGAGAGAGAGGTGCTAGCAGCCAAACCCAAGATCACGCGCATTACACATCTCAATCTACAACCCCAGGAGCGCCAGGCCTTTTACAGGCTCCTAGAAAATGAGCTGATTCAGGAATTTCTTTCTATGGACTCCTGTCTAAAGATTTCAGACAAGTATCTCATAGCAATGGTTCTAGCATATTTTAAGCGGGCAGGCCTCTACACCGGCGAGTACACAACCATGAATTTCTTTGTTGCTCTGTATCTGGCTAATGACATGGAGGAAGATGAAGAAGACTATAAATATGAAATCTTCCCCTGGGCACTAGGAGATTCATGGCGTGAGTTTTTCCCACAATTTTTACGTCTCCGGGACAACTTCTGGGCTAAAATGAACTACCGAGCAGTTGTTAGCCGAAGATGTTGTGATGAGGTAATGGCGAAAGATCCCACTCATTGGGCCTGGCTCAGAGATCGTCCTATTCATCATAGTGGGGCCCTGCGTGGTTACCTCACAGATGAGGATGACTTTTTCCCTCGGGGTCCAGGCCTTACACCAACCCAGCTGTGCACTTTGCCCTAAAGCAAGTGTCTGTGACTCTGGTGGGGGTCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGCATATGCAGAGTGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837521
dbEST ID: 79655223
Trimmed Sequence: AAGGTGGTGCCATTCCAAGGCTGCCCCATCTGGCTCTAATCCAACCAACGGTTCCTGGAAAATGTGGATGTCATAAGTAGACTCCGGATCCAATAACAGTTCAGGTGGCAAGATGAGAAGTTCCTGGGACCACTCCCTATTGGTGTAGTGAAAAATCTCTTGTTCTGGAGAAGAGTTGTCATGGGCGACCCCACCAGAGTCACAGACACTTGCTTTATGGCAAAGTGCACAGCTGGCTGGTGTAAGGCCTGGACCCCGAGGGAAAAAGTCATCCTCATTTCTGAGGTAACCACGCAGGGCCCCACTATGATGAATAGGACGATCTCTGAGCCAGGCCCAATGAGTGGGATCTTTCGCCATTACCTCATCACAACATCTTCGGCTAACAACTGCTCGGTAGTTCATTTTAACCCAGAACTTGTCCCGGAGACATAAAAATTGTGGGAAAAACTCACACCATGAATCTCCTAGTGCCCAGGGGAAAATTTATATTTATAGTCTTCCTCATTCTCCCTCCTGTCAATAACCAGATACCGAAGCAACAAAAAAAGTCCATGGCTTGTGTAGTCCCCAGTGTTAAAAGCCTGCACGGCTTAAAATATGCCAAGAAACAATTGCTAAGAAAAGTATTTGTTTTAAAATCTTTTTGAAAGGAATTTCATAAGAAAAAAAATTCCCTGAAATCACCCCACTTTTTTAAGAAAACCCTGAAAAAGGGCCCTGGGCGCCCCC
Full Trace Sequence: CGTGCAAAAAGCTACTGACCATGTAATACGACTCACTATANGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGGTGGTGCCATTCCAAGGCTGCCCCATCTGGCTCTAATCCAACCAACGGTTCCTGGAAAATGTGGATGTCATAAGTAGACTCCGGATCCAATAACAGTTCAGGTGGCAAGATGAGAAGTTCCTGGGACCACTCCCTATTGGTGTAGTGAAAAATCTCTTGTTCTGGAGAAGAGTTGTCATGGGCGACCCCACCAGAGTCACAGACACTTGCTTTATGGCAAAGTGCACAGCTGGCTGGTGTAAGGCCTGGACCCCGAGGGAAAAAGTCATCCTCATTTCTGAGGTAACCACGCAGGGCCCCACTATGATGAATAGGACGATCTCTGAGCCAGGCCCAATGAGTGGGATCTTTCGCCATTACCTCATCACAACATCTTCGGCTAACAACTGCTCGGTAGTTCATTTTAACCCAGAACTTGTCCCGGAGACATAAAAATTGTGGGAAAAACTCACACCATGAATCTCCTAGTGCCCAGGGGAAAATTTATATTTATAGTCTTCCTCATTCTCCCTCCTGTCAATAACCAGATACCGAAGCAACAAAAAAAGTCCATGGCTTGTGTAGTCCCCAGTGTTAAAAGCCTGCACGGCTTAAAATATGCCAAGAAACAATTGCTAAGAAAAGTATTTGTTTTAAAATCTTTTTGAAAGGAATTTCATAAGAAAAAAAATTCCCTGAAATCACCCCACTTTTTTAAGAAAACCCTGAAAAAGGGCCCTGGGCGCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGGTGGTGCCATTCCAA