ORFeome > spef1 ORF1 – XORFeome v1.0

spef1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: spef1
Gene ID: 6252466
Gene Page ID: 1003953
ORF Xenbase ID: 17298393

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123353
Original XGC clone length: 690

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ837318
dbEST ID: 79655020
Trimmed Sequence: ATGGCGGTGGAGTTTGATGAGGAGACAATGCAGGAGCTGTACACCTGGGTGGACACAATCCCCTTATCCAGACCCAAAAGGAACATCGCCAGGGATTTCAGTGACGGCGTGCTGACGGCTGAGCTGGTGAAGTTTTATTTCCCTAAACTTGTGGAAATGCACAACTACGTGCCGGCCAATTCGACCACTCAGAAACTCAGCAACTGGACTATACTGAACAGGAAAGTTCTCAGCAAGCTCAGCTTCTCTGTTCCTGATGACGTGATCCGTAAGATTGTCCAGTGCTCCCCGGGGGTCGTGGAGCTGGTACTTAATACCTTGCGGCAGAAGATCGAGGAGAAGCAGAGACTACATCACATTTCAGCTGATTTATCTCAGGATCAAGCGACACAGAATAATGGAAACACTCACTCTGATAAAGGGTATAAAAGCAATGGCACAGAACTCAGCCCGAGACAAGGTGCCCGGGTGGATCCAGCAAGTAAAACACACCAAGGATATGCCCAGGCGGCCAACGCTGACACCACCCTGCGCTTCCAGCTGGCAGAGAAGGAGCAGACTTTGATCTTATCACAGGAGACTATTCAGATTCTGCAGGCGAAGTTGCGGCGGCTGGAGCAGCTCCTTCTGTTGAAGAACGTCCGCATTGAAGATCTGACCCGGCGACTGCAAGAACTGGAAAAAAAATGCCAACTTTCCTGTACAAGGTTTGCCATTATAGAAAGCATTGCCTTTCATTTTGTTTCCCCGGAACGGGTCCCCATCACGTCAAAAAAAAACGCATTATTTTTCCCAACAAAAAAAAAAAAAAACAACAAAAA
Full Trace Sequence: TCGGGGCCCCAATAATAGATTTTATTTNTGACTGATAGTGACCTGNTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGGAGTTTGATGAGGAGACAATGCAGGAGCTGTACACCTGGGTGGACACAATCCCCTTATCCAGACCCAAAAGGAACATCGCCAGGGATTTCAGTGACGGCGTGCTGACGGCTGAGCTGGTGAAGTTTTATTTCCCTAAACTTGTGGAAATGCACAACTACGTGCCGGCCAATTCGACCACTCAGAAACTCAGCAACTGGACTATACTGAACAGGAAAGTTCTCAGCAAGCTCAGCTTCTCTGTTCCTGATGACGTGATCCGTAAGATTGTCCAGTGCTCCCCGGGGGTCGTGGAGCTGGTACTTAATACCTTGCGGCAGAAGATCGAGGAGAAGCAGAGACTACATCACATTTCAGCTGATTTATCTCAGGATCAAGCGACACAGAATAATGGAAACACTCACTCTGATAAAGGGTATAAAAGCAATGGCACAGAACTCAGCCCGAGACAAGGTGCCCGGGTGGATCCAGCAAGTAAAACACACCAAGGATATGCCCAGGCGGCCAACGCTGACACCACCCTGCGCTTCCAGCTGGCAGAGAAGGAGCAGACTTTGATCTTATCACAGGAGACTATTCAGATTCTGCAGGCGAAGTTGCGGCGGCTGGAGCAGCTCCTTCTGTTGAAGAACGTCCGCATTGAAGATCTGACCCGGCGACTGCAAGAACTGGAAAAAAAATGCCAACTTTCCTGTACAAGGTTTGCCATTATAGAAAGCATTGCCTTTCATTTTGTTTCCCCGGAACGGGTCCCCATCACGTCAAAAAAAAACGCATTATTTTTCCCAACAAAAAAAAAAAAAAACAACAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGGAGTTTGATGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837317
dbEST ID: 79655019
Trimmed Sequence: TTTCTTCTCCAGTTCTTGCAGTCGCCGGGTCAGATCATCAATGCGGACGTTCTTCAACAGAAGGAGCTGCTCCAGCCGCCGCAACTTCGCCTGCAGAATCTGAATAGTCTCCTGTGATAAGATCAAAGTCTGCTCCTTCTCTGCCAGCTGGAAGCGCAGGGTGGTGTCAGCGTTGGCCGCCTGGGCATATCCTTGGTGTGTTTTACTTGCTGGATCCACCCGGGCACCTTGTCTCGGGCTGAGTTCTGTGCCATTGCTTTTATACCCTTTATCAGAGTGAGTGTTTCCATTATTCTGTGTCGCTTGATCCTGAGATAAATCAGCTGAAATGTGATGTAGTCTCTGCTTCTCCTCGATCTTCTGCCGCAAGGTATTAAGTACCAGCTCCACGACCCCCGGGGAGCACTGGACAATCTTACGGATCACGTCATCAGGAACAGAGAAGCTGAGCTTGCTGAGAACTTTCCTGTTCAGTATAGTCCAGTTGCTGAGTTTCTGAGTGGTCGAATTGGCCGGCACGTAGTTGTGCATTTCCACAAGTTTAGGGAAATAGAACTTCACCAGCTCAGCCGTCAGCACGCCGTCACTGAAATCCCTGGCGATTTTCCTTTTGGGTCTGGAGAAGGGGATTGTGGGCGGCCCAGGTGTACGCGGCCCTGCGTTGTCTCCCCATCATAAACCCACAACAATGATCCCCAATTTTTTGGTAGAGAAGTTGGCTTTGAGAAAAGAAGGAGTGGTTCCCTCGTTTTAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTCTCCAGTTCTTGCAGTCGCCGGGTCAGATCATCAATGCGGACGTTCTTCAACAGAAGGAGCTGCTCCAGCCGCCGCAACTTCGCCTGCAGAATCTGAATAGTCTCCTGTGATAAGATCAAAGTCTGCTCCTTCTCTGCCAGCTGGAAGCGCAGGGTGGTGTCAGCGTTGGCCGCCTGGGCATATCCTTGGTGTGTTTTACTTGCTGGATCCACCCGGGCACCTTGTCTCGGGCTGAGTTCTGTGCCATTGCTTTTATACCCTTTATCAGAGTGAGTGTTTCCATTATTCTGTGTCGCTTGATCCTGAGATAAATCAGCTGAAATGTGATGTAGTCTCTGCTTCTCCTCGATCTTCTGCCGCAAGGTATTAAGTACCAGCTCCACGACCCCCGGGGAGCACTGGACAATCTTACGGATCACGTCATCAGGAACAGAGAAGCTGAGCTTGCTGAGAACTTTCCTGTTCAGTATAGTCCAGTTGCTGAGTTTCTGAGTGGTCGAATTGGCCGGCACGTAGTTGTGCATTTCCACAAGTTTAGGGAAATAGAACTTCACCAGCTCAGCCGTCAGCACGCCGTCACTGAAATCCCTGGCGATTTTCCTTTTGGGTCTGGAGAAGGGGATTGTGGGCGGCCCAGGTGTACGCGGCCCTGCGTTGTCTCCCCATCATAAACCCACAACAATGATCCCCAATTTTTTGGTAGAGAAGTTGGCTTTGAGAAAAGAAGGAGTGGTTCCCTCGTTTTAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTCTCCAGTTCTTGCAGT