ORFeome > spint2 ORF1 – XORFeome v1.0

spint2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: spint2
Gene ID: 947336
Gene Page ID: 947328
ORF Xenbase ID: 17298441

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099367
Original XGC clone length: 948

Human orthology & disease relationships

NCBI Entrez ID: 10653
Ensembl gene IDs: ENSG00000167642
Directly associated (OMIM) disease MIM numbers: 270420
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ840176
dbEST ID: 79657878
Trimmed Sequence: ATGGCGGTGTGGTTGGGTGGCCTCCTGCTGCTTATGTTCCCTTTGGCGCTGGCACAGCAGCAGCCAGCATGTGATGGATACGAGGTCTTGGATGGGGTTGGTCTGCCTGCGATAGGTACACCGGCTCGGCAGCTAATGATTGAGCTAGACTCATCACGGGTCGCCAACTCCGAGCAGGACTGTTGGGATCTTTGTTGTTCCACCGAGCGCTGCGAACTGGCTGAGATGTCCGAGGGAAATTGCAAACTGATCAGCTGTATGTACAGTGGCTTCAACATGTGTGAGCTGAAGAACAAAGAAGGAGTCAGAAGTTTTCGCAAAAACGACATTGGGCCAACACCCACCCAGAAAGATTTCTGCTTACCAGAAGCTGTCACAGGACCATGCAGAGCTGCATTTGAAAGGTGGTGGTACAACCCAGAGACCCAGACCTGCCAAAATTTTACTTATGGTGGCTGCAAAGGAAATCTGAACAACCATATTGGCGAAGAGGAGTGCATGAATAAATGCACTGGAGTCACAGCTGAACTGTCCAATGATATATTGTCACCAAGTAAACGTATGGTTGAAGAAAATGTGGACCAGGCTTGTTCTGGGAAAGGGGTAGTGGGCACTGCCCGGCTTCCTTCCCTCGTTTGTACTTTGATGCTTAATCCCAGGCCTGTGTATCTTTCCATAATGGTTGGAATGTGACGGCCCGAAAAACAACCACAATCTCCTAAATTAAATGCAAAAAACAGGTTTTATTTGTTTTCCCAAACCCTAAACCCTTGCAAAAATTTTTAA
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGTGGTTGGGTGGCCTCCTGCTGCTTATGTTCCCTTTGGCGCTGGCACAGCAGCAGCCAGCATGTGATGGATACGAGGTCTTGGATGGGGTTGGTCTGCCTGCGATAGGTACACCGGCTCGGCAGCTAATGATTGAGCTAGACTCATCACGGGTCGCCAACTCCGAGCAGGACTGTTGGGATCTTTGTTGTTCCACCGAGCGCTGCGAACTGGCTGAGATGTCCGAGGGAAATTGCAAACTGATCAGCTGTATGTACAGTGGCTTCAACATGTGTGAGCTGAAGAACAAAGAAGGAGTCAGAAGTTTTCGCAAAAACGACATTGGGCCAACACCCACCCAGAAAGATTTCTGCTTACCAGAAGCTGTCACAGGACCATGCAGAGCTGCATTTGAAAGGTGGTGGTACAACCCAGAGACCCAGACCTGCCAAAATTTTACTTATGGTGGCTGCAAAGGAAATCTGAACAACCATATTGGCGAAGAGGAGTGCATGAATAAATGCACTGGAGTCACAGCTGAACTGTCCAATGATATATTGTCACCAAGTAAACGTATGGTTGAAGAAAATGTGGACCAGGCTTGTTCTGGGAAAGGGGTAGTGGGCACTGCCCGGCTTCCTTCCCTCGTTTGTACTTTGATGCTTAATCCCAGGCCTGTGTATCTTTCCATAATGGTTGGAATGTGACGGCCCGAAAAACAACCACAATCTCCTAAATTAAATGCAAAAAACAGGTTTTATTTGTTTTCCCAAACCCTAAACCCTTGCAAAAATTTTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGTGGTTGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ840175
dbEST ID: 79657877
Trimmed Sequence: CACAGTCGTCCTTGTTAAGGTAATTGTTTTTGTTTCCGCGGCATCCTCCATAAGTGAATGTAGCACAGGTGCCAGTTGTTGTATCGTAGTGCCAGCGAAGGAAAGATGCACGGCATGGACCAGTTGAACTTGCTGCTGCGCAGTACTCGCTGTAGCTGCCAGTCTTGGTGCTTGAACTTTTGCAGGTTCTGGTTTGGAAACAATACACCTGTCTCTGCACTCATTCTCAGACTTGTGGTTGTTCTCCGTGCCGTCACATCCACCATATGTGAAAGATACACAGGCCTGGGATTCAGCATCAAAGTACCAACGAGGGAAGGAAGCCCGGCAGTTGCCCACTACCCCTTTCCCAGAACAAGCCTGGTCCACATTTTCTTCAACCATACGTTTACTTGGTGACAATATATCATTGGACAGTTCAGCTGTGACTCCNGTGCATTTATTCATGCACTCCTCTTCGCCAATATGGTTGTTCAGATTTCCTTTGCAGCCACCATAAGTAAAATTTTGGGAGGTCTGGGTCTCTGGATTGTAACACCACCCTTTCAATGCAGCTCTGCCTGGGTCCGGTGAAAGCTTCCTGGTAACAAAAAATCTTTCTGGGTGGGGGTTGGCCCAATGTCGTTTTATGCAAAAACTTCTTAACCCCTTCCTTTGGTTCTTCACCCCCACATGTTTGAAGCCACTTGTAAATAAAAATCTTAATCAATTTTGCAAATTCCCATTCGGAAAATCCATAACCCAATTCCCCCACCAGCTTTGGAGTGGAAAAAAACAAAA
Full Trace Sequence: GGAAAATGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACAGTCGTCCTTGTTAAGGTAATTGTTTTTGTTTCCGCGGCATCCTCCATAAGTGAATGTAGCACAGGTGCCAGTTGTTGTATCGTAGTGCCAGCGAAGGAAAGATGCACGGCATGGACCAGTTGAACTTGCTGCTGCGCAGTACTCGCTGTAGCTGCCAGTCTTGGTGCTTGAACTTTTGCAGGTTCTGGTTTGGAAACAATACACCTGTCTCTGCACTCATTCTCAGACTTGTGGTTGTTCTCCGTGCCGTCACATCCACCATATGTGAAAGATACACAGGCCTGGGATTCAGCATCAAAGTACCAACGAGGGAAGGAAGCCCGGCAGTTGCCCACTACCCCTTTCCCAGAACAAGCCTGGTCCACATTTTCTTCAACCATACGTTTACTTGGTGACAATATATCATTGGACAGTTCAGCTGTGACTCCNGTGCATTTATTCATGCACTCCTCTTCGCCAATATGGTTGTTCAGATTTCCTTTGCAGCCACCATAAGTAAAATTTTGGGAGGTCTGGGTCTCTGGATTGTAACACCACCCTTTCAATGCAGCTCTGCCTGGGTCCGGTGAAAGCTTCCTGGTAACAAAAAATCTTTCTGGGTGGGGGTTGGCCCAATGTCGTTTTATGCAAAAACTTCTTAACCCCTTCCTTTGGTTCTTCACCCCCACATGTTTGAAGCCACTTGTAAATAAAAATCTTAATCAATTTTGCAAATTCCCATTCGGAAAATCCATAACCCAATTCCCCCACCAGCTTTGGAGTGGAAAAAAACAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACAGTCGTCCTTGTTAAGGTA