ORFeome > spop ORF2 – XORFeome v1.0

spop ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: spop
Gene ID: 1003315
Gene Page ID: 1003309
ORF Xenbase ID: 17298477

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123148
Original XGC clone length: 1125

Human orthology & disease relationships

NCBI Entrez ID: 8405
Ensembl gene IDs: ENSG00000121067
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,125853,259500,260370,300367,606392

Library Location

Plate ID: GDExl11088
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ838192
dbEST ID: 79655894
Trimmed Sequence: ATGTCGCGAGTACCCAGTCCCCCTCCCCCAGCTGAGATGTCCAGTGGCCCTGTGGCAGAAAGCTGGTGCTATACTCAGATTAAAGTCGTCAAGTTTTCCTACATGTGGACCATCAACAATTTTAGCTTTTGCCGAGAGGAGATGGGGGAGGTGATCAAGAGCTCAACCTTCTCTTCAGGCGCCAATGATAAACTCAAATGGTGCTTGCGGGTTAATCCCAAGGGACTGGATGAGGAGAGTAAAGATTATCTATCTCTCTACTTACTATTGGTCAGTTGTCCAAAGAGTGAGGTGCGTGCCAAATTCAAATTCTCCATTCTAAATGCCAAAGGAGAAGAAACAAAGGCAATGGAGAGTCAACGTGCCTACCGGTTTGTCCAGGGGAAGGACTGGGGCTTCAAGAAATTTATCCGCAGGGACTTTTTACTTGATGAGGCCAATGGCCTGCTTCCAGATGACAAACTAACACTGTTCTGTGAGGTTAGTGTGGTGCAGGATTCTGTCAACATTTCTGGCCAGAACACAATGAACATGGTCAAAGTCCCAAAATGCCGCCGTTCAAATGAACTTGGAGGACTGTGGGAGAAGTCTCATTTCCCCGACTGCTGTCTCTGTGTGGCTGGGCGGGAAGTTCAGGCACACGAGGGCCTCCTTGGCGCCCGGGGCCCCTGTGTTAATGGGCTGTTTTGAGCTTTAATTGGAAAAAAACGAAAAAGAACATTGTGAAGAAAGGAGAGCGGGGAACCCGAGGCG
Full Trace Sequence: TCGAGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGCGAGTACCCAGTCCCCCTCCCCCAGCTGAGATGTCCAGTGGCCCTGTGGCAGAAAGCTGGTGCTATACTCAGATTAAAGTCGTCAAGTTTTCCTACATGTGGACCATCAACAATTTTAGCTTTTGCCGAGAGGAGATGGGGGAGGTGATCAAGAGCTCAACCTTCTCTTCAGGCGCCAATGATAAACTCAAATGGTGCTTGCGGGTTAATCCCAAGGGACTGGATGAGGAGAGTAAAGATTATCTATCTCTCTACTTACTATTGGTCAGTTGTCCAAAGAGTGAGGTGCGTGCCAAATTCAAATTCTCCATTCTAAATGCCAAAGGAGAAGAAACAAAGGCAATGGAGAGTCAACGTGCCTACCGGTTTGTCCAGGGGAAGGACTGGGGCTTCAAGAAATTTATCCGCAGGGACTTTTTACTTGATGAGGCCAATGGCCTGCTTCCAGATGACAAACTAACACTGTTCTGTGAGGTTAGTGTGGTGCAGGATTCTGTCAACATTTCTGGCCAGAACACAATGAACATGGTCAAAGTCCCAAAATGCCGCCGTTCAAATGAACTTGGAGGACTGTGGGAGAAGTCTCATTTCCCCGACTGCTGTCTCTGTGTGGCTGGGCGGGAAGTTCAGGCACACGAGGGCCTCCTTGGCGCCCGGGGCCCCTGTGTTAATGGGCTGTTTTGAGCTTTAATTGGAAAAAAACGAAAAAGAACATTGTGAAGAAAGGAGAGCGGGGAACCCGAGGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGCGAGTACCCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838191
dbEST ID: 79655893
Trimmed Sequence: GGATTGCTTCAGGCGTTTGCGTGGAGGCCCCAGGAAGGGGCATTGGGCGGATGCTAGTGAGCGATATGCTTCTGCTACCAGGTGTGGGTGAGAGACCACCATAGACTTCCATCCCGACGTTTCCATGACATCAGAGGCGTGGTAATTGATGAAGTCCACAGCCTGTGTTTTCAGTTGATCTGCGCTGTGTAAGTCGGCCAAGATCAGGATTTCTGCTGCATTTTCTACCGACAGGTTACTGCACAGCGCTTCCTCGCACATCACTTTCAGGCGTTCCAGGGCATACTTGTCTGCTGCAGCCAATAAATCATCGGCCATTTTATCAAGGTTGGAGGCTTTCCCCGTGTAGATGAAACACATCATTTCTTTAAACACATCCGGTTCCACGTCTTTTATCTCCACACGGTTCTTTTTGCTCTCTTCCATTTCATGTTCAAACATGGCGCTAAACACAGGAGACCGCACTGCCAGGATGGCTTTGTGTGCCTGAAATTCTTGACCAGCCACACAGAGACAGCAGTCGGTGAAACGAGAATTCTCCCACAGTCCTCCCACTTCATCTGATAGGCGGCAGTCTGGGGACTTTGAACATGTTCATTGTGGTTCTGGCCCGAAGTGGTTAACGAATCCTGCACCCCGACGAACCCCCAGAAAAATGTTAAATTTGTCATCTGGAAAACAGGCCATTGGGCCGCCTTGAATAAAAAAATTCCCGGCGAAAAAAATTGCTTGGAAACCCCCCCTCCCCTCCCCCCCGGGACGGA
Full Trace Sequence: GGGGAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGATTGCTTCAGGCGTTTGCGTGGAGGCCCCAGGAAGGGGCATTGGGCGGATGCTAGTGAGCGATATGCTTCTGCTACCAGGTGTGGGTGAGAGACCACCATAGACTTCCATCCCGACGTTTCCATGACATCAGAGGCGTGGTAATTGATGAAGTCCACAGCCTGTGTTTTCAGTTGATCTGCGCTGTGTAAGTCGGCCAAGATCAGGATTTCTGCTGCATTTTCTACCGACAGGTTACTGCACAGCGCTTCCTCGCACATCACTTTCAGGCGTTCCAGGGCATACTTGTCTGCTGCAGCCAATAAATCATCGGCCATTTTATCAAGGTTGGAGGCTTTCCCCGTGTAGATGAAACACATCATTTCTTTAAACACATCCGGTTCCACGTCTTTTATCTCCACACGGTTCTTTTTGCTCTCTTCCATTTCATGTTCAAACATGGCGCTAAACACAGGAGACCGCACTGCCAGGATGGCTTTGTGTGCCTGAAATTCTTGACCAGCCACACAGAGACAGCAGTCGGTGAAACGAGAATTCTCCCACAGTCCTCCCACTTCATCTGATAGGCGGCAGTCTGGGGACTTTGAACATGTTCATTGTGGTTCTGGCCCGAAGTGGTTAACGAATCCTGCACCCCGACGAACCCCCAGAAAAATGTTAAATTTGTCATCTGGAAAACAGGCCATTGGGCCGCCTTGAATAAAAAAATTCCCGGCGAAAAAAATTGCTTGGAAACCCCCCCTCCCCTCCCCCCCGGGACGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATTGCTTCAGGCGTTT