ORFeome > spred1 ORF1 – XORFeome v1.0

spred1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: spred1
Gene ID: 864915
Gene Page ID: 482850
ORF Xenbase ID: 17298507

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124893
Original XGC clone length: 1218

Human orthology & disease relationships

NCBI Entrez ID: 161742
Ensembl gene IDs: ENSG00000166068
Directly associated (OMIM) disease MIM numbers: 611431
Indirectly associated (Lage, et al.) disease MIM numbers: 172800,600802,606764

Library Location

Plate ID: GDExl11092
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ838757
dbEST ID: 79656459
Trimmed Sequence: ATGAGCGGCGAACAGGAGCCAGATGACAGTTATGCACGAGTGCGAGCTGTGGTGATGACAAGGGATGACTCGAGTGGTGGTTGGCTACAACTTGGAGGTGGAGGGCTCAGCTCTGTTACCGTGTCTAAGACTCTACAACCTGGAGATGGTGGTGCCACAGAATATCTAGTTCATGGAGAGAGACTCCGAGATAAGACGGTGGTCTTGGAATGTGTGCTCAGGAGGGATCTTGTCTACAACAAAGTTACCCCTACATTCCATCACTGGAAAATCGGAGACAAGAAGTTCGGCCTTACGTTCCAAAGTCCAGCGGACGCCCGAGCTTTTGATAGAGGAATACGTCGTGCCATTGAAGACCTGTGTCAAGGTTTACCCGCATCTTGCCATGGAGAGTCAGAAGCTTCTGAGGATGGACCACAGGTGAACAAAGAAGACCATTACAGCACTCATAACAACGATCACTTTTTCCGAAGCGACTCTATACCAATTGACGAACTGTATCGCACCTCTGTCATCAGACCCTCCCCATTTGATCCGAACCCAAGGAGAGCCTACCTCCACAACCAGGTTCCTCTCAAGCCACTTCGACATGTCAGCTTCCAGGACGAAGATTAAATAGTCCGCATTAACCCTCGCGACATGATCATTCGTCGCTATGCGGATTACCGGCACCCAGACATCTTTTCGGAATGATGCTGATCGGGAAGGAACCAAAAAATGTTTAGCCTCTTTACCAAAAAAGAAAAGTTAAAA
Full Trace Sequence: CGGCGTGTATAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCGGCGAACAGGAGCCAGATGACAGTTATGCACGAGTGCGAGCTGTGGTGATGACAAGGGATGACTCGAGTGGTGGTTGGCTACAACTTGGAGGTGGAGGGCTCAGCTCTGTTACCGTGTCTAAGACTCTACAACCTGGAGATGGTGGTGCCACAGAATATCTAGTTCATGGAGAGAGACTCCGAGATAAGACGGTGGTCTTGGAATGTGTGCTCAGGAGGGATCTTGTCTACAACAAAGTTACCCCTACATTCCATCACTGGAAAATCGGAGACAAGAAGTTCGGCCTTACGTTCCAAAGTCCAGCGGACGCCCGAGCTTTTGATAGAGGAATACGTCGTGCCATTGAAGACCTGTGTCAAGGTTTACCCGCATCTTGCCATGGAGAGTCAGAAGCTTCTGAGGATGGACCACAGGTGAACAAAGAAGACCATTACAGCACTCATAACAACGATCACTTTTTCCGAAGCGACTCTATACCAATTGACGAACTGTATCGCACCTCTGTCATCAGACCCTCCCCATTTGATCCGAACCCAAGGAGAGCCTACCTCCACAACCAGGTTCCTCTCAAGCCACTTCGACATGTCAGCTTCCAGGACGAAGATTAAATAGTCCGCATTAACCCTCGCGACATGATCATTCGTCGCTATGCGGATTACCGGCACCCAGACATCTTTTCGGAATGATGCTGATCGGGAAGGAACCAAAAAATGTTTAGCCTCTTTACCAAAAAAGAAAAGTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCGGCGAACAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838756
dbEST ID: 79656458
Trimmed Sequence: TCCAGCTGCTTTATGCTTCCCACCGCAGCAGCCACACATCTCACCACAATGGTGACAGGCGCGCAGCGGAGGATAGCAGCACATACAGGGGGCTATAAAAGATAATGTGATTAGAGCCAGCCAGCGCAGACACAGGTTTTCATCAGAGGCGTCACAAGAGCATGGGTCGGAATAATCTCCTTCAGAGTCTGACATGCAGTGGTAGAGCATGCTCTCAGCGCACAGCATGCAGCTGACCTGGTAAATGCACCTCTGGATGGGGTCTGGTGCATCCTGGCACTTCCCCCTTCCATTCTCCTCGTGGTTAAATCGTTCCTGGCAGTATACACATCTTGACCGTTCTCCATCCTCTTTTTTTCTTTTGGACTTTTTTAGAGAGGACGTTGGCTGAATCTTACAAACTTCAGCCGTTTTTGGCTCCTTAAAAGAGTCTCTGCCATTGGCTGGGGAATAGAGATAGCTGGGCTTTTTACTGTCTGTCTTGGTAAAGAGCGTAACATCTTCTGGTTCCTCCCGATCAGCATCATTCCGAAAGATGTCTGGGTGCCGGTAATCCGCATAGCGACGAATGATCATGTCGCGAGGGTTAATGCGGACTATTTCATCTTCGTCCTGGAACTGAACATGTCGAAGTGGCTTGAGAGGAACTGGGTTTGTGGAAGGTAGGCTCTCCTTGGGGTTCGATACAAAATGGGGAAGGGTCTGGATGACAGAGGGTTGCGATACAGGTTCCGTCAAATT
Full Trace Sequence: GGGAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCAGCTGCTTTATGCTTCCCACCGCAGCAGCCACACATCTCACCACAATGGTGACAGGCGCGCAGCGGAGGATAGCAGCACATACAGGGGGCTATAAAAGATAATGTGATTAGAGCCAGCCAGCGCAGACACAGGTTTTCATCAGAGGCGTCACAAGAGCATGGGTCGGAATAATCTCCTTCAGAGTCTGACATGCAGTGGTAGAGCATGCTCTCAGCGCACAGCATGCAGCTGACCTGGTAAATGCACCTCTGGATGGGGTCTGGTGCATCCTGGCACTTCCCCCTTCCATTCTCCTCGTGGTTAAATCGTTCCTGGCAGTATACACATCTTGACCGTTCTCCATCCTCTTTTTTTCTTTTGGACTTTTTTAGAGAGGACGTTGGCTGAATCTTACAAACTTCAGCCGTTTTTGGCTCCTTAAAAGAGTCTCTGCCATTGGCTGGGGAATAGAGATAGCTGGGCTTTTTACTGTCTGTCTTGGTAAAGAGCGTAACATCTTCTGGTTCCTCCCGATCAGCATCATTCCGAAAGATGTCTGGGTGCCGGTAATCCGCATAGCGACGAATGATCATGTCGCGAGGGTTAATGCGGACTATTTCATCTTCGTCCTGGAACTGAACATGTCGAAGTGGCTTGAGAGGAACTGGGTTTGTGGAAGGTAGGCTCTCCTTGGGGTTCGATACAAAATGGGGAAGGGTCTGGATGACAGAGGGTTGCGATACAGGTTCCGTCAAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCAGCTGCTTTATGCTTC