ORFeome > spry2 ORF1 – XORFeome v1.0

spry2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: spry2
Gene ID: 864828
Gene Page ID: 482100
ORF Xenbase ID: 17298513

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124885
Original XGC clone length: 945

Human orthology & disease relationships

NCBI Entrez ID: 10253
Ensembl gene IDs: ENSG00000136158
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 607785,608354,608355

Library Location

Plate ID: GDExl11089
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ838241
dbEST ID: 79655943
Trimmed Sequence: ATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAATGGACGATTACACAGTGACACTGACCCACGGGAGATTTTAACACAGCAAGTTCATGTTTTGTCCTTGGAACAAATAAGAGCCATAAGAAACAGTAATGAATATACAGAAGGGCCCACAGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCGACCTTTTGTCAGGACTCCACATGCACCAATGCATTCCTTGTTTCAGGCATCTTTGTCTCGATCAGTTGGTGCAGCCAGTTCATCTTCTCGGAGCAATACAAGGACAAGTAGCAGTTCTTCAGAGCAAAGGCTTCTTGTACCACCATTTACATCTTCAGGGGTGGTTGCAGACCGAATAATTCGAGTACAGCCTAAACCTGAACTGAAATCTGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGACTTACATTCATTAATGTGTGAGGATTGTGGAAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCANGAAGTAGTTGACTATGGAACTTGTGCTTGCTGTGTGAAGTGCCTTTTCTATCACTGTTCAAATGATGAATAAGGATAATTGTTGCGAACAACCCATGTTCTTTGCATTCCGTCCCACCTGCCTGCCCTCCAATTGGCCGGCCCATTGGCCGTTCCTGGGCCCTGGTTCTTTGCCCCC
Full Trace Sequence: CGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAATGGACGATTACACAGTGACACTGACCCACGGGAGATTTTAACACAGCAAGTTCATGTTTTGTCCTTGGAACAAATAAGAGCCATAAGAAACAGTAATGAATATACAGAAGGGCCCACAGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCGACCTTTTGTCAGGACTCCACATGCACCAATGCATTCCTTGTTTCAGGCATCTTTGTCTCGATCAGTTGGTGCAGCCAGTTCATCTTCTCGGAGCAATACAAGGACAAGTAGCAGTTCTTCAGAGCAAAGGCTTCTTGTACCACCATTTACATCTTCAGGGGTGGTTGCAGACCGAATAATTCGAGTACAGCCTAAACCTGAACTGAAATCTGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGACTTACATTCATTAATGTGTGAGGATTGTGGAAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCANGAAGTAGTTGACTATGGAACTTGTGCTTGCTGTGTGAAGTGCCTTTTCTATCACTGTTCAAATGATGAATAAGGATAATTGTTGCGAACAACCCATGTTCTTTGCATTCCGTCCCACCTGCCTGCCCTCCAATTGGCCGGCCCATTGGCCGTTCCTGGGCCCTGGTTCTTTGCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGACGAGAGTACAAAATGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838240
dbEST ID: 79655942
Trimmed Sequence: TGTTGGTTTTTCTAAGTTCCTGGGCTGAAGGTGTGGAACTTTAAGGCAAACTGTGTTTGATCTTTTGCATTGACATCCAGGTCTATTTACGCGGTCATAGCAGCCCTGGCACAATTTAAGGCAACCCTTGGCTGGAAGGTAACACCACAAACAGGGCAAGAACAAGGCCATGACGCCNATGGCAGACCATCGAGTGCAGCAGTGGGACTGACTGCAAGAACATGGGTTGTCCGCACAATTATCCTCATCATCATTTGAACAGTGATAGAAAAGGCACTTCACACAGCAAGCACAAGTTCCATAGTCAACTACTTCCTGGGCTGAGCAAAGGCACTGCTTGTCACAAATCCAACAAGATGGGAGAGTCCTTGGATAAGTGCATTCTTGGCACTTACATTTTCCACAATCCTCACACATTAATGAATGTAAGTCCAATTCCTCTTTACTAGAGGGCTTTAAAATGTCAGATTTCAGTTCAAGTTTAGGCTGTACTCGAATTATTCGGTCTGCAACCACCCCTGAAGATGTAAATGGTGGTACAAGAAGCCTTTGCTCTGAAAAACTGCTACTTGTCCTTGTATTGCTCCCAGAAATGAACTGGCTGCACCACCTGATCAAAAAAAAAAATGCCCGAAACAAGGGAATGCCTTGGTGCAAGGGGAATTCCTGAACAAAAGGTCGCCTCCTCATTTTACCCCAGTGTTATTCCTTTTCATTTTTTTTCTTTTTGGGGTAAAGTCG
Full Trace Sequence: GTGAAAACAGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTTGGTTTTTCTAAGTTCCTGGGCTGAAGGTGTGGAACTTTAAGGCAAACTGTGTTTGATCTTTTGCATTGACATCCAGGTCTATTTACGCGGTCATAGCAGCCCTGGCACAATTTAAGGCAACCCTTGGCTGGAAGGTAACACCACAAACAGGGCAAGAACAAGGCCATGACGCCNATGGCAGACCATCGAGTGCAGCAGTGGGACTGACTGCAAGAACATGGGTTGTCCGCACAATTATCCTCATCATCATTTGAACAGTGATAGAAAAGGCACTTCACACAGCAAGCACAAGTTCCATAGTCAACTACTTCCTGGGCTGAGCAAAGGCACTGCTTGTCACAAATCCAACAAGATGGGAGAGTCCTTGGATAAGTGCATTCTTGGCACTTACATTTTCCACAATCCTCACACATTAATGAATGTAAGTCCAATTCCTCTTTACTAGAGGGCTTTAAAATGTCAGATTTCAGTTCAAGTTTAGGCTGTACTCGAATTATTCGGTCTGCAACCACCCCTGAAGATGTAAATGGTGGTACAAGAAGCCTTTGCTCTGAAAAACTGCTACTTGTCCTTGTATTGCTCCCAGAAATGAACTGGCTGCACCACCTGATCAAAAAAAAAAATGCCCGAAACAAGGGAATGCCTTGGTGCAAGGGGAATTCCTGAACAAAAGGTCGCCTCCTCATTTTACCCCAGTGTTATTCCTTTTCATTTTTTTTCTTTTTGGGGTAAAGTCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTTGGTTTTTCTAAGTTCCTGG