ORFeome > sqrdl ORF1 – XORFeome v1.0

sqrdl ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: sqrdl
Gene ID: 957734
Gene Page ID: 957725
ORF Xenbase ID: 17298585

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC054152
Original XGC clone length: 1335

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ839217
dbEST ID: 79656919
Trimmed Sequence: ATGTCTCCGGGCCTCCATGTCCATCAGTGCACACAGTTACTGAGAGCGGCAATTCAGAGTGGAAGCTGTAGGACCCTGCACATGAGCCCAAGATCAGCGGCAAAGGAATACTATGATGTGGTTGTAGTTGGAGGTGGTGCTGGTGGTATCACTATGAGTGCTCGCATGAAGAGGAAAGTAGGAGCTGGAAAGGTCGCTGTCATAGAGCCAAGCGAGACACACTATTACCAGCCAATGTGGACGCTAGTTGGTGGTGGTGCTAAGAAACTAGCAAGCTCAGCACGTCCTACAGCGAGTGTAATCCCATCTGGTGTCAAATGGATTAAATCAGAAGTGAAAGGCTTCGACCCCGAAAAGAACTGCATCCGGATAGATGATGACAAAGAGATAAGCTACAAATATTTGATTATTGCACTTGGACTGAAACTGCATTATGAAAAGATTAAAGGTTTGCCAGAAGGCTTTAACTATCCCAAAATTGGCTCCAACTACTCTGTACAAACCGTTGAAAAGACATGGAAAGCACTGCAAGATTTTAAGAAGGGGAATGCCATATTTACATTTCCAAACTCTCCTGTGAAATGTGCTGGTGCTCCTCAGAAAATCATGTATCTATCAAAAGAATATCTAACGGAAAACGGGAAAAAGAAGCCCAATCCAACATCCTCTTCAACAACATCCTTCGGGGGTAATCTTTGGGGGTGAAGAAGGTCCCAAAACCCTCTCCCCAAAAAATCATCCAAAAAAAGAAATAACCCAAGTTAAACCTCCCAAGCCCTTAATCCGGGAAAA
Full Trace Sequence: CTCGGGGCCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTCCGGGCCTCCATGTCCATCAGTGCACACAGTTACTGAGAGCGGCAATTCAGAGTGGAAGCTGTAGGACCCTGCACATGAGCCCAAGATCAGCGGCAAAGGAATACTATGATGTGGTTGTAGTTGGAGGTGGTGCTGGTGGTATCACTATGAGTGCTCGCATGAAGAGGAAAGTAGGAGCTGGAAAGGTCGCTGTCATAGAGCCAAGCGAGACACACTATTACCAGCCAATGTGGACGCTAGTTGGTGGTGGTGCTAAGAAACTAGCAAGCTCAGCACGTCCTACAGCGAGTGTAATCCCATCTGGTGTCAAATGGATTAAATCAGAAGTGAAAGGCTTCGACCCCGAAAAGAACTGCATCCGGATAGATGATGACAAAGAGATAAGCTACAAATATTTGATTATTGCACTTGGACTGAAACTGCATTATGAAAAGATTAAAGGTTTGCCAGAAGGCTTTAACTATCCCAAAATTGGCTCCAACTACTCTGTACAAACCGTTGAAAAGACATGGAAAGCACTGCAAGATTTTAAGAAGGGGAATGCCATATTTACATTTCCAAACTCTCCTGTGAAATGTGCTGGTGCTCCTCAGAAAATCATGTATCTATCAAAAGAATATCTAACGGAAAACGGGAAAAAGAAGCCCAATCCAACATCCTCTTCAACAACATCCTTCGGGGGTAATCTTTGGGGGTGAAGAAGGTCCCAAAACCCTCTCCCCAAAAAATCATCCAAAAAAAGAAATAACCCAAGTTAAACCTCCCAAGCCCTTAATCCGGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCCGGGCCTCCATGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839216
dbEST ID: 79656918
Trimmed Sequence: CTTGAATCCAAGGTGCATGATTTTTCTGTATGGAGCAGGTCCTCCCCAGTATCCCCTGAGAAGTAACTGCCAGTAGAGGAAAGGCATCATATCGGCCTTCATGTGATACATTGTTCTCCTCTCTTTTCCCTGGTCAATGGGGAAAGTCTCTAACGGTTGTTGGTTGTAGTCAAACTCTGCCAAAATCACTTTCCGGTACCCGGTTACCAATGGGCATGAAGTGTAGCCATCATACTTTGATGATGGACTCTGGTTTTTCATCACAAGTGATATGGTTTTATTGAGCACTGCTGATTGGGCAGCTATTGCAGCTGCAGTTTTTGATGTTGGAAGGTTTGTACAGTCTCCTATGCCAAAAACATTTGGATACTTTTTGTGCTGCAGATTGTCCTTGCTTACATCCACCCAACCGGCTGCATCTGAGACTGGACTGTTCATCAGAACATCAGGTGGTCCCATGGGTGGGGTTACATGGAGCATTTCATACTGAAAAACTTTGGTTTCACCCGGTTTGTCTAAATTCTCAAACACAGCTTCCTGGATGTCTGGCCGCACCTCTATCAGGTTATGGCTGTAGTTTACTTGGGATATTCTCTCTTTGATAATCTTCTGGAAAAGCTCTGCGTACTTCTTCACCCCAAAAAAAACCCCCAAACAATTTGTTGAAAAATAATTTTGGGCATCGGCCTCGTTTTCCCCGTTTTCCCAAAAAAACCCCCCCTTAAAAAAAAAACTGGAATTTTTTGAAAGAGAACCC
Full Trace Sequence: GCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTGAATCCAAGGTGCATGATTTTTCTGTATGGAGCAGGTCCTCCCCAGTATCCCCTGAGAAGTAACTGCCAGTAGAGGAAAGGCATCATATCGGCCTTCATGTGATACATTGTTCTCCTCTCTTTTCCCTGGTCAATGGGGAAAGTCTCTAACGGTTGTTGGTTGTAGTCAAACTCTGCCAAAATCACTTTCCGGTACCCGGTTACCAATGGGCATGAAGTGTAGCCATCATACTTTGATGATGGACTCTGGTTTTTCATCACAAGTGATATGGTTTTATTGAGCACTGCTGATTGGGCAGCTATTGCAGCTGCAGTTTTTGATGTTGGAAGGTTTGTACAGTCTCCTATGCCAAAAACATTTGGATACTTTTTGTGCTGCAGATTGTCCTTGCTTACATCCACCCAACCGGCTGCATCTGAGACTGGACTGTTCATCAGAACATCAGGTGGTCCCATGGGTGGGGTTACATGGAGCATTTCATACTGAAAAACTTTGGTTTCACCCGGTTTGTCTAAATTCTCAAACACAGCTTCCTGGATGTCTGGCCGCACCTCTATCAGGTTATGGCTGTAGTTTACTTGGGATATTCTCTCTTTGATAATCTTCTGGAAAAGCTCTGCGTACTTCTTCACCCCAAAAAAAACCCCCAAACAATTTGTTGAAAAATAATTTTGGGCATCGGCCTCGTTTTCCCCGTTTTCCCAAAAAAACCCCCCCTTAAAAAAAAAACTGGAATTTTTTGAAAGAGAACCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTGAATCCAAGGTGCATGATTT