ORFeome > sqstm1 ORF1 – XORFeome v1.0

sqstm1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: sqstm1
Gene ID: 5919104
Gene Page ID: 5918987
ORF Xenbase ID: 17298597

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056852
Original XGC clone length: 1365

Human orthology & disease relationships

NCBI Entrez ID: 8878
Ensembl gene IDs: ENSG00000161011
Directly associated (OMIM) disease MIM numbers: 602080
Indirectly associated (Lage, et al.) disease MIM numbers: 602080

Library Location

Plate ID: GDExl11003
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ839493
dbEST ID: 79657195
Trimmed Sequence: ATGACGGTCACCGTGAAAGCCTATCTGCTGGGCAAGGATGAGAGTCACAAGGAGATCCGCCGCTTCCAGCTCGAGCTGCCAGTCGCTGGCAAAGGGAAGGCGGCCTCTTCCGGGTCCAGCTGCGAGATCCTCGCTAACAAGGTGACAGATGTCTTCCAGGGCCTGAAAGGGGGAGCCTTCCAGATGTTCTACAAAGATGAAGAAGGGGACCTGGTTGCATTTTCTACCGATGAGGAACTTCATATGGGCCTTTCTCTGCTGAATGAAGATGTGTTTCGTATTTACATTAAAGAGAAGAAAGAGTGCAAACGTGATCATCGTGGACACTGCGGGCAGGAAACCCAACAAAACGTTGTTCACCCAAACGTGACCTGTGATGGATGTGATGGTCCTGTAGTGGGAAACAGGTTTAAGTGCCTCATCTGCCCAGATTATGATCTATGCAGCACTTGTGAGAAGAAAGGAATCCACAAGGAACACAACATGATCATGTTCCCTACCCCACTGGTCTATCCACGTGGCCGTTGGTTCCGTAAAATGCACCATGGAGTTCCCAATTTCCCTTGGATGCAGGGCTGGACTGTTCCACCCAGAGGATACCCCTGCCACAAATATCAGCAGGCCCCAGAAAGCACCCCTCCTCAGAATGAACCCCCTGCAGAGGAAGCTGCAGCCTCCAGTGACCCACAGTCTTCTCAAAATCCATTGGTGACTTCCCTANNAATGTGGGGAGAGAGTGTGGCTGCCATGCTGAACCCCCCGGGGCCTTGAGGGTGGGACATGAATTTTGAAACAATGGTGGGGAAAAGGAACCAAAATTTTCGGACTT
Full Trace Sequence: GGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACGGTCACCGTGAAAGCCTATCTGCTGGGCAAGGATGAGAGTCACAAGGAGATCCGCCGCTTCCAGCTCGAGCTGCCAGTCGCTGGCAAAGGGAAGGCGGCCTCTTCCGGGTCCAGCTGCGAGATCCTCGCTAACAAGGTGACAGATGTCTTCCAGGGCCTGAAAGGGGGAGCCTTCCAGATGTTCTACAAAGATGAAGAAGGGGACCTGGTTGCATTTTCTACCGATGAGGAACTTCATATGGGCCTTTCTCTGCTGAATGAAGATGTGTTTCGTATTTACATTAAAGAGAAGAAAGAGTGCAAACGTGATCATCGTGGACACTGCGGGCAGGAAACCCAACAAAACGTTGTTCACCCAAACGTGACCTGTGATGGATGTGATGGTCCTGTAGTGGGAAACAGGTTTAAGTGCCTCATCTGCCCAGATTATGATCTATGCAGCACTTGTGAGAAGAAAGGAATCCACAAGGAACACAACATGATCATGTTCCCTACCCCACTGGTCTATCCACGTGGCCGTTGGTTCCGTAAAATGCACCATGGAGTTCCCAATTTCCCTTGGATGCAGGGCTGGACTGTTCCACCCAGAGGATACCCCTGCCACAAATATCAGCAGGCCCCAGAAAGCACCCCTCCTCAGAATGAACCCCCTGCAGAGGAAGCTGCAGCCTCCAGTGACCCACAGTCTTCTCAAAATCCATTGGTGACTTCCCTANNAATGTGGGGAGAGAGTGTGGCTGCCATGCTGAACCCCCCGGGGCCTTGAGGGTGGGACATGAATTTTGAAACAATGGTGGGGAAAAGGAACCAAAATTTTCGGACTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACGGTCACCGTGAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839492
dbEST ID: 79657194
Trimmed Sequence: GGAGTTAGGAATGTGGCGGATAGACTGCATGGCGTCCAGAGCAGACCCAATATCGTATTGTTTTGCCTCCAAGAGCCGAGTGAGCCACCCTCCTTCATCTGAGAAGCCCATGGACAGCATCTGTGAAAGGGTTTCTATGAGGCGAGGATCTGCTTCTGGTGGGAGGTGTGGATAAAGGGCAGCTTCTCTCAGTCCTGTAGGTGCGTGTGTGGGCACAGCAGAGGATCTATTTGGATCTAAGGAACATGGCTGGCCTGTCTCAATGAGCTGAAGGGACTGGAGTTCACCAGTGGAGGGATCAACTTCTTTGGATGAGACATGAGTCCAGTCGTCATCACCCACTGCAGTGCCATTGCTGTTTTCCCCTTGTTCATTGTCTTGTGGAAGAGAAGAATTCAGTGCAATATCTTTCATTCTTTTTGCGATTTGCTCAGTTTCCATGAGATTAGGTGAAGAGTCAGATCGGCTGCCAATTTCCTGGCTTTCCATGAAAAAGTTGGAGCTGTTTGGCTGTGAATTTCCGTCCACAAAACAGGGATGTGAAGTCGAAACTTTAAGTCCTTTTCCACCCTGCCTCGCGTGGATGTCCACATCCATGCCCCAGGGGCGCTCCCCAGTGCACCCACACTTCTCTCCCACAATTTTAAAAGGAATTCAACTTGGCGAATTTTTAAGAGGAACTTTACAATCACATGAGAGGCGGGAGGGTGCGCCGTCGCGGGGGGGTCCTTTCCCAGAGGGGGGGGGGACCCTATTGGTTTGGGCGCGG
Full Trace Sequence: GAACCGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGTTAGGAATGTGGCGGATAGACTGCATGGCGTCCAGAGCAGACCCAATATCGTATTGTTTTGCCTCCAAGAGCCGAGTGAGCCACCCTCCTTCATCTGAGAAGCCCATGGACAGCATCTGTGAAAGGGTTTCTATGAGGCGAGGATCTGCTTCTGGTGGGAGGTGTGGATAAAGGGCAGCTTCTCTCAGTCCTGTAGGTGCGTGTGTGGGCACAGCAGAGGATCTATTTGGATCTAAGGAACATGGCTGGCCTGTCTCAATGAGCTGAAGGGACTGGAGTTCACCAGTGGAGGGATCAACTTCTTTGGATGAGACATGAGTCCAGTCGTCATCACCCACTGCAGTGCCATTGCTGTTTTCCCCTTGTTCATTGTCTTGTGGAAGAGAAGAATTCAGTGCAATATCTTTCATTCTTTTTGCGATTTGCTCAGTTTCCATGAGATTAGGTGAAGAGTCAGATCGGCTGCCAATTTCCTGGCTTTCCATGAAAAAGTTGGAGCTGTTTGGCTGTGAATTTCCGTCCACAAAACAGGGATGTGAAGTCGAAACTTTAAGTCCTTTTCCACCCTGCCTCGCGTGGATGTCCACATCCATGCCCCAGGGGCGCTCCCCAGTGCACCCACACTTCTCTCCCACAATTTTAAAAGGAATTCAACTTGGCGAATTTTTAAGAGGAACTTTACAATCACATGAGAGGCGGGAGGGTGCGCCGTCGCGGGGGGGTCCTTTCCCAGAGGGGGGGGGGACCCTATTGGTTTGGGCGCGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGTTAGGAATGTGGCGGA