ORFeome > src ORF2 – XORFeome v1.0

src ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: src
Gene ID: 6252879
Gene Page ID: 489819
ORF Xenbase ID: 17298609

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110764
Original XGC clone length: 1599

Human orthology & disease relationships

NCBI Entrez ID: 6714
Ensembl gene IDs: ENSG00000197122
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,102200,103580,104300,104310,109800,114480,114500,115150,123400,123500,125853,130060,131960,135300,137440,148700,151623,160980,162210,163955,164200,166200,166210,166220,166350,174800,186100,193100,193520,202400,211900,211980,218040,225060,226650,226730,233700,233710,245300,255960,256300,259420,262190,268000,273800,275355,300436,300558,303600,304110,304400,306400,600072,600995,601553,601777,602875,603218,604370,606688,607276,607685,607785,607832,607907,608203,608232,608354,608355,609307,609352,609942,609968

Library Location

Plate ID: GDExl11087
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGTTCAAGAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTGCCACTGAAAGTAAGCCACGAGAAGGCGGGCCACGGAGTCGCAGTCTGGATATTGTGGAAGGGTCCCACCAGCCTGGGGACAACCTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAATGAGTCGTATTACCTGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCNAAAAAAAAAAAAAAAAAAGAAAAAAATAGAAATATATCATCATGCCTCCGGAAAAAAAGCCAGGACATAAATGCCACAACGTCCCTGCGAGTTAAGGTTGCCGGGTGACGAACACCGTGGAAACGGATGAAAGCACCAACGCAGTGGACATAACCCTGTTAGGTTAGTAAGCTGGAGTGCAAGTAGCGTATGCACTCACGCAACTGGTCCAGAACCTTGACCGAACGGCGGGGTGGTAACGGCGCAATGGCGGTTTTCATGGCTTGTTTAGACTGTCTTTTTGGGCGACAATCACAGGTCCCGGGGATCGGGGTTATTAGTGTGTTACGCCGTGGGTCTATTTTTGATGGTTTCGATCCACAACAAATTTAAACATAAAGGGGGGGGGCTCCTAAACAAAATTTAACCATAAGAAGGGAAGGGGGTTTCTCCCTAGCCTCCTCCCCCCCAATCCTAAGGGGATTGTGGGTATTTCGACCGGCCAATCTTAAAAGCAACGTTTGGTAGATATATTATTTTTGTTTGGCTGTGCACTCATAAGGAGGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTGCCACTAAAAGTAAG

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AAAAGGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAAAAGGTTGTCCCCAGGCTGGTGGGACCCTTCCACAATATCCAGACTGCGACTCCATGGCCCGCCTTCTCGTGGCTTACTTTCAGTGGCACCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCAACCATTAGACAGNGTCNTCGNNTTNNAAAAAAAAACAACCAAGAAAAACAATACATGCGAGGCGTCTGCCATGGCAGGGCCGGAAAAAAAACGGCAACCCTTCTCGCGCAAACCGGGGCGCCTGATTAATGCTCCTTGGGGACTGAAGGAGGCGCAAAAACAAATGGACTAACCCGGGTTCGGGTTAAACCGGTGAAGGAAGATAAGCCTGGGCGCCCACCCACGTGGGCGAAAACTTTAACAAGACCAGAGGGGTGAACGGGGCGCGAGGGGGGTAATTGTGTTTTNGTAAAATTATTTTTNTTNGNAANNNNNNNNNNNNGNGGNNNCNNNNNNAGANNGGNNNNNNGGGGGGNNNGGGGNNANGGNNNNNNNNNGNNGAGNNGAGGGGNANGGANNNNGNNNNNGNNGNNNNNNNGNGAGGGNGGNNNGGANANNNNNNNNANNNNNGGNNNNNNNNNNGNNNNNGGGGNNNNGGNNNGNNNGNNNNNANNGGNNGGNANANNNGNNNNAANNNNNGNGGNNNNNNGNAGANNNGGNGGNNNGNNGNNGGNNGNGGGNNGGNNGNNNNNNNGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGGTTGTCCCCAGGCTGGT