ORFeome > sri ORF2 – XORFeome v1.0

sri ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sri
Gene ID: 952120
Gene Page ID: 952116
ORF Xenbase ID: 17298639

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129654
Original XGC clone length: 591

Human orthology & disease relationships

NCBI Entrez ID: 6717
Ensembl gene IDs: ENSG00000075142
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,600274,606889,607822

Library Location

Plate ID: GDExl11090
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ838701
dbEST ID: 79656403
Trimmed Sequence: ATGGCGTATCAGGGGCAGCATCCAGGAGGAGGCTACTACCAAGGAGGGTATGGCGGAGCCCCCGGGGGTCCTGCATATGGGCAGCAGCAAGACCCCATGTATGGCTACTTTGCATCTGTCGCAGGCCAGGATGGCCAGATAGATGCTGATGAGCTACAGCGGTGCCTCACACAAGCAGGGCTCTCTGGGGGATACAAACCTTTTAACCTGGAAAGTTGCCGTCTTATGATCGCTATGCTGGATAGGGATATGTCAGGCAAAATGGGCTTTAATGAATTCAAAGAACTGGGGATGGTAATAACTGGTTGGAGACAGCACTTCATGACGTATGATTCCTATAGAATTGGCACAGTTGAGGGGCATGAACTTCATGCCACCTTGGGAACAATGGAGGTATAGGTTGAACCCTCGAGGCCGGAAGAGAGAGGGGGGAATGTACAGCAGAAATCGGGGGAGGGGCCGTGGAAGAGAACAAAACCCCTATACCGGACTCCGTACGTGTGAGAAACAATGTGGGGAAGAAGGGAGGGGGTGCCATGCTGGGGTGGTGGGGGGGGCAGAGGGTGGGGGGGCTGGGGGACGGGCGGGGGCGGGCGTCAGGAGGGGTGGGGGCCGAGGGAGGGGGGGGGAATGGGATAATGGTTGGGGTGATGATGTGTTTGGGGGGGAGAGGGGGGGGATCAAGAAGAAGAAAAAAAAATAGGGGGGGCGCGGGGAGGGGAGGGGGGGGGGCGAAGAGGGAGAAA
Full Trace Sequence: CTCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGTATCAGGGGCAGCATCCAGGAGGAGGCTACTACCAAGGAGGGTATGGCGGAGCCCCCGGGGGTCCTGCATATGGGCAGCAGCAAGACCCCATGTATGGCTACTTTGCATCTGTCGCAGGCCAGGATGGCCAGATAGATGCTGATGAGCTACAGCGGTGCCTCACACAAGCAGGGCTCTCTGGGGGATACAAACCTTTTAACCTGGAAAGTTGCCGTCTTATGATCGCTATGCTGGATAGGGATATGTCAGGCAAAATGGGCTTTAATGAATTCAAAGAACTGGGGATGGTAATAACTGGTTGGAGACAGCACTTCATGACGTATGATTCCTATAGAATTGGCACAGTTGAGGGGCATGAACTTCATGCCACCTTGGGAACAATGGAGGTATAGGTTGAACCCTCGAGGCCGGAAGAGAGAGGGGGGAATGTACAGCAGAAATCGGGGGAGGGGCCGTGGAAGAGAACAAAACCCCTATACCGGACTCCGTACGTGTGAGAAACAATGTGGGGAAGAAGGGAGGGGGTGCCATGCTGGGGTGGTGGGGGGGGCAGAGGGTGGGGGGGCTGGGGGACGGGCGGGGGCGGGCGTCAGGAGGGGTGGGGGCCGAGGGAGGGGGGGGGAATGGGATAATGGTTGGGGTGATGATGTGTTTGGGGGGGAGAGGGGGGGGATCAAGAAGAAGAAAAAAAAATAGGGGGGGCGCGGGGAGGGGAGGGGGGGGGGCGAAGAGGGAGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGTATCAGGGGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838700
dbEST ID: 79656402
Trimmed Sequence: TATGGCCATGACAGTCTGAATGAAATCATCATACTGGAAGTTCACTACACCCTGTTGGGAAACATCCCTCCTCCTGAACAAGTCTGTCAGAGCTCGCAGTTTCACACAGCAGGTAATGTAATCATCAAAGGTGATTCTTCCATTTGTGCTGTATCTTTTTGCTATATTATTCAGTGCCTGAGGGCTCAACCTATACCCCATTGCTCCCAAGGCGGCATGAAGTTCATGCCCCTCAACTGTGCCACTCCTATCGGAATCATACGTCATGAAGTGCTGTCTCCAACCAGTTATTACCATCCCCAGTTCTTTGAATTCATTAAAGCCCATTTTGCCTGACATATCCCTATCCAGCATAGCGATCATAAGACAGCAACTTTCCAGGTTAAAAGGTTTGTATCCCCCACAGAGCCCTGCTTGTGTGAGGCACCGCTGTAGCTCATCAGCATCTATCTGGCCATCCTGGCCTGCGACAGATGCAAAGTAGCCATACATGTGGTCTTGCTGCTGCCCATATGCAGGACCCCCCGGGGGCTCCCCATACCCTCCCTTGTAGTAGGCTTCCTCCCTGAGGCGGCTCCTAAACGCCAATGTGCCAACGTTTTTTACAAAGTTGGCGTTATGAAAAAACATTGCTCATCAAATTGTTTCCATGAAGGGGTAGCCTATCCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAACAAAAATAGTCACCCCTCCTGCCCCCCCGAGCTCGTCAACAAAAGAAAAAACTCCCCCCTTCTCCTCTACACTC
Full Trace Sequence: AAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATGGCCATGACAGTCTGAATGAAATCATCATACTGGAAGTTCACTACACCCTGTTGGGAAACATCCCTCCTCCTGAACAAGTCTGTCAGAGCTCGCAGTTTCACACAGCAGGTAATGTAATCATCAAAGGTGATTCTTCCATTTGTGCTGTATCTTTTTGCTATATTATTCAGTGCCTGAGGGCTCAACCTATACCCCATTGCTCCCAAGGCGGCATGAAGTTCATGCCCCTCAACTGTGCCACTCCTATCGGAATCATACGTCATGAAGTGCTGTCTCCAACCAGTTATTACCATCCCCAGTTCTTTGAATTCATTAAAGCCCATTTTGCCTGACATATCCCTATCCAGCATAGCGATCATAAGACAGCAACTTTCCAGGTTAAAAGGTTTGTATCCCCCACAGAGCCCTGCTTGTGTGAGGCACCGCTGTAGCTCATCAGCATCTATCTGGCCATCCTGGCCTGCGACAGATGCAAAGTAGCCATACATGTGGTCTTGCTGCTGCCCATATGCAGGACCCCCCGGGGGCTCCCCATACCCTCCCTTGTAGTAGGCTTCCTCCCTGAGGCGGCTCCTAAACGCCAATGTGCCAACGTTTTTTACAAAGTTGGCGTTATGAAAAAACATTGCTCATCAAATTGTTTCCATGAAGGGGTAGCCTATCCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAACAAAAATAGTCACCCCTCCTGCCCCCCCGAGCTCGTCAACAAAAGAAAAAACTCCCCCCTTCTCCTCTACACTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATGGCCATGACAGTCTGAA