ORFeome > srp14 ORF1 – XORFeome v1.0

srp14 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: srp14
Gene ID: 6252969
Gene Page ID: 489793
ORF Xenbase ID: 17298651

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097760
Original XGC clone length: 333

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ838383
dbEST ID: 79656085
Trimmed Sequence: ATGGTTCTGTTGGAGAGTGAGCAGTTTCTCACAGAGCTTACACGTTTGTTCCAGAAATGCCGGACATCAGGGAGTGTTTATATTACACTAAAAAAATATGACGGTCGAACGAAGCCAGTTCCACGGAAAGGCCAGTCTGAGAGCTTTGAACCAGCAGATAACAAATGCCTTCTGAGAGCGACGGACGGGAAGAAGAAAATCAGCACAGTGGTCAGCTCAAAAGAAGTCAACAAGTTCCAAATGGCCTACTCCAACCTCCTCCGGGCGAATATGGATGGACTGAAAAAGAAAGACAAGAAGAGTAAAAATAAAAAGAGCAGTGCGGCTCAATT
Full Trace Sequence: TCGGGGGCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTTCTGTTGGAGAGTGAGCAGTTTCTCACAGAGCTTACACGTTTGTTCCAGAAATGCCGGACATCAGGGAGTGTTTATATTACACTAAAAAAATATGACGGTCGAACGAAGCCAGTTCCACGGAAAGGCCAGTCTGAGAGCTTTGAACCAGCAGATAACAAATGCCTTCTGAGAGCGACGGACGGGAAGAAGAAAATCAGCACAGTGGTCAGCTCAAAAGAAGTCAACAAGTTCCAAATGGCCTACTCCAACCTCCTCCGGGCGAATATGGATGGACTGAAAAAGAAAGACAAGAAGAGTAAAAATAAAAAGAGCAGTGCGGCTCAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCAAAAAAAAAAAAAACACAAATGTTACAGGCCCCCCCTCGCCGAAGGAGGGGGAAAAAAAAAAAAAAAAGAATCATCCCAAAGGAGGGGGGGGGGGGTTCCTTTGGGCTGGGAGGAGGAGGGAGCCCCCACCCCCCCAAGACAACTGCCGGTGGGGGGGGGGGAGAAGAATTAGCGAGAAGAGACACGCCGGACGGGGCAGCAACCCCCAGAAAAACTTAACTCCGCGGTGGGAGGGGGGTGAAGGGGCTTTTTGTGTCTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTCTGTTGGAGAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838382
dbEST ID: 79656084
Trimmed Sequence: TTGAGCCGCACTGCTCTTTTTATTTTTACTCTTCTTGTCTTTCTTTTTCAGTCCATCCATATTCGCCCGGAGGAGGTTGGAGTAGGCCATTTGGAACTTGTTGACTTCTTTTGAGCTGACCACTGTGCTGATTTTCTTCTTCCCGTCCGTCGCTCTCAGAAGGCATTTGTTATCTGCTGGTTCAAAGCTCTCAGACTGGCCTTTCCGTGGAACTGGCTTCGTTCGACCGTCATATTTTTTTAGTGTAATATAAACACTCCCTGATGTCCGGCATTTCTGGAACAAACGTGTAAGCTCTGTGAGAAACTGCTCACTCTCCCACAGAACCATGG
Full Trace Sequence: GGGGGAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGAGCCGCACTGCTCTTTTTATTTTTACTCTTCTTGTCTTTCTTTTTCAGTCCATCCATATTCGCCCGGAGGAGGTTGGAGTAGGCCATTTGGAACTTGTTGACTTCTTTTGAGCTGACCACTGTGCTGATTTTCTTCTTCCCGTCCGTCGCTCTCAGAAGGCATTTGTTATCTGCTGGTTCAAAGCTCTCAGACTGGCCTTTCCGTGGAACTGGCTTCGTTCGACCGTCATATTTTTTTAGTGTAATATAAACACTCCCTGATGTCCGGCATTTCTGGAACAAACGTGTAAGCTCTGTGAGAAACTGCTCACTCTCCCACAGAACCATGGTGCCAACTTTTTTGTACAAAGTTGCCATTATAAAAAAGCATTGCTCATCAGTTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGAAAACAAAAAAAGAAAAAATACAATGTCTATCCTCCGCGAGGAACGGCAGGGGAAGAAAAAAAAAGGGGGCAACGGCAGGGAGGGGGGGGTTTTTTCTGGTTGGGGGGGGGGAGCGCCCCCCCGCGAGAAAAACGCTGGGGGGGGAGGGTAGAAGAGGAAGGAACAGGGGCGAGCCGAGGGGGGGGGAACANGGAAAGAAGAAGAAGGGGGGGGGGGGGGGGNGGGGNTGGGGGGTGAGGGAGGGGTGGGTGGGGGGNGNNCNGGGGGGNGGNGGGGGGGGGAGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGAGCCGCACTGCTCTT