ORFeome > srpk2 ORF1 – XORFeome v1.0

srpk2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: srpk2
Gene ID: 6255896
Gene Page ID: 990796
ORF Xenbase ID: 17298687

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097709
Original XGC clone length: 75

Human orthology & disease relationships

NCBI Entrez ID: 6733
Ensembl gene IDs: ENSG00000135250
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 194050,223100,259500

Library Location

Plate ID: GDExl11089
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGTTCTATAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACGCCGACAAGGTGCTGGCCATTCAGGCCCGGAAAAGGAGACCGAAAGGAAAAAAAAGAAAAGACTCGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAAGCGAAATCCCCTATATTGATTCTTATTACATTGGTCCTAGCTGTTTCCTGGCAGCTCTGGCTCCTGTCTCAACAAAAGAAAAAAAAAGAAAAAAATACACCGATCTACTAGATGCCCCGGCGAGAAAAAAAAGACAGAATTATCTCAAAAACGGGGGCTACGTAGAATCCCGTGTGAGACGCGAAGAGCCCCCGACATAGGAGAGAAAACACCCATTGCGAAAAATCATGCCTTGGTAAGAAAGGAGATATGAAAGCAACGTATGACATCCCCAAACAAGGCCAACATAAGATACTCGCCTGAAGCCGGGTGGGAACTGAGTAGTGAAAGAATTTTTTGTATAGTAGAAAACTTCCCTTTTCACGTCACCACATAAAAGTCTTCTTATGACCTAAGATTAAGATTTTTAAGCGAGGCCAGAAAACCACACCCTCTTAACGCAGACACCGGAACCGGGGACCCTTAAGACGTTAATTTTGGTATTTAGAAGACTATTCCCTTTACGTCACCCAAACACAATTATCCCACCTTGCAATGTGCATAAAACCTGTAAAAGATTTATAATTTTTTATTGGTATTTAAAAGAAATAAAGTTTTGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACGCCGGCAAGGT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GCGGAAACGGCTATGGACCATGGTATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATATGATTTTATTTTNACTNATANTNACCTNTTCNTTNCNNCAATTNATAANCAATNCTTTCTTATAATNCCAACTTTNTACAANAAANTTNNCAACNANTCTTTTCTTTTTTTTCCTTTCNNTCTCCTTTTCCNNNCCTNAATNNCCANCACCTTNCCNNCCTTCCTNCTNCCTACTTTTTTCTCCCCNTTTTCATTATACTAAATCATTTCTCATCATTTCCTTCCAACCAACATTCACTTATCCTTCAAAATAAAATCATTATTTACAACACACACNATATACNNNNNANNNNTACAAAAAAAAAAAAAAAAATATTACATCTTCCCCTCCAAACACCCCTCACAAAAAACAACCCAACTTCTTCCTACACACCNNTTCCTCCTAAATCACAACTTTTCTTTTTAAACATATCAACCCCACCTAACAAACACCCTTCTNTTCTAATCATTTTTNAANNAAAATANANACATTCTCAACAANNTCNAAACAAATTATNANNCCNNAAANNTTNNNAAACANNANNNNANNNTTTTTTANAAAAAAANATNTTNNNNCACNNNNNNNCNCANNNACNNNAAAAANNNAANATAAATANAAAANAACAANNTTTNNAANNNANNTTAAAAATAAAACATNNACCTNNNCNNAAAAAANNATATNAAANNNANNANAAAANTTNAAAAAAAAAACAAATNAANAAATNAAANNTACAAAAAANNNNNAAANNANNNANNNAANNANNNNANNTTNACCNATAACATCNANNTACNNTNNNNTAAATNNATNTANAANNAANNANACCNNNNNAAAAATAATATAAANNNAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGAGTCTTTTCTTTTTTTTCCTT