ORFeome > srprb ORF1 – XORFeome v1.0

srprb ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: srprb
Gene ID: 6253420
Gene Page ID: 952556
ORF Xenbase ID: 17298693

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054231
Original XGC clone length: 795

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ839263
dbEST ID: 79656965
Trimmed Sequence: ATGGCTGAGGCTGCGGTACAAAATGATTCCCGCTGGTTGCCGGACTTAGAGTTCATTAAACAGGAGCTGCAAAGGCAAGACCCGACCTTGCTCTCCGTGGGCATCGCCCTGATTGTTGTGTTGCTGAGCTTTGTTCTATGGAAAATTCTGAGAGGCAGTCGGATCAGCCGAAGAGCAGTGCTGCTTGTTGGACTCTGTGACTCCGGAAAAACTCTTCTTTTCAACAGGTTGCTTACAGGAACATACAAGAAAACCCAAACCTCTATCACTGCCAATTCTGCTGCATATAAAGTGAAAAGTGACAAGGGGACCAGTTTGACACTTGTTGACCTTCCTGGTCACGAAAGTTTGAGGCATCAATTCCTGGAGCAATATAAAGCATCAGCAAGGGCCTTGCTGTTTGTAGTGGACAGTTCAGCATTCCAGCGTGAGGTGAAAGAGGTGGCTGAGCTCCTTTACCAACTATTGACAGATGTTGCAGTACTGAAGAATGCTCCACCAATACTCATTGCTTGCAATANACAAGATATTTCAATGGCCAAATCAGCCAAACTTGTACAGCAGCAGTTGGAGAAAGAGCTGAACACTCTTCGTGTCACTCGCTCGGCTGCTCCTACCACCCTGGAAAGTAGCAACTCGGGTGTCGCACAGCTTGGGAAGAAAGGCAAAGACTTCGATTTTACCCAGTTACCTATGAAGGTAAAATTCCTGGAAATGGCAGCACCCATGAACGGTAAAA
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGGCTGCGGTACAAAATGATTCCCGCTGGTTGCCGGACTTAGAGTTCATTAAACAGGAGCTGCAAAGGCAAGACCCGACCTTGCTCTCCGTGGGCATCGCCCTGATTGTTGTGTTGCTGAGCTTTGTTCTATGGAAAATTCTGAGAGGCAGTCGGATCAGCCGAAGAGCAGTGCTGCTTGTTGGACTCTGTGACTCCGGAAAAACTCTTCTTTTCAACAGGTTGCTTACAGGAACATACAAGAAAACCCAAACCTCTATCACTGCCAATTCTGCTGCATATAAAGTGAAAAGTGACAAGGGGACCAGTTTGACACTTGTTGACCTTCCTGGTCACGAAAGTTTGAGGCATCAATTCCTGGAGCAATATAAAGCATCAGCAAGGGCCTTGCTGTTTGTAGTGGACAGTTCAGCATTCCAGCGTGAGGTGAAAGAGGTGGCTGAGCTCCTTTACCAACTATTGACAGATGTTGCAGTACTGAAGAATGCTCCACCAATACTCATTGCTTGCAATANACAAGATATTTCAATGGCCAAATCAGCCAAACTTGTACAGCAGCAGTTGGAGAAAGAGCTGAACACTCTTCGTGTCACTCGCTCGGCTGCTCCTACCACCCTGGAAAGTAGCAACTCGGGTGTCGCACAGCTTGGGAAGAAAGGCAAAGACTTCGATTTTACCCAGTTACCTATGAAGGTAAAATTCCTGGAAATGGCAGCACCCATGAACGGTAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGGCTGCGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839262
dbEST ID: 79656964
Trimmed Sequence: AACTAGCTTAGCCAGCCAGCCCTCTACATTACTAATGTTGGCATCCCCATCCTCTTCTTTACTGTCATGGGTGCTGCATTCCAGGAATTTTACCTTCATAGGTAACTGGGTAAAATCGAAGTCTTTGCCTTTCTTCCCAAGCTGTGCGACACCCGAGTTGCTACCTTCCAGGGTGGTAGGAGCAGCCGAGCGAGTGACACGAAGAGTGTTCAGCTCTTTCTCCAACTGCTGCTGTACAAGTTTGGCTGATTTGGCCATTGAAATATCTTGTTTATTGCAAGCAATGAGTATTGGTGGAGCATTCTTCAGTACTGCAACATCTGTCAATAGTTGGTAAAGGAGCTCAGCCACCTCTTTCACCTCACGCTGGAATGCTGAACTGTCCACTACAAACAGCAAGGCCCTTGCTGATGCTTTATATTGCTCCAGGAATTGATGCCTCANACTTTCGTGACCAGGAAGGTCAACAAGTGTCAAACTGGTCCCCTTGTCACTTTTCACTTTATATGCAGCAGAATTGGCAGTGATAGAGGGTTTGGGGTTTTCTTGTATGTTCCTGTAAGCAACCTGTTGAAAAGAAGGATTTTTTCCGGGAGTCACAGAAGCCCAACAAGCAGCACTGCCTCTCCCGCTGATCCAACTGCCTCTCAGAATTTTCCATAGAACAAAAGCTCAACAACACAACCATTCAGGGCCAATCCCCA
Full Trace Sequence: GAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACTAGCTTAGCCAGCCAGCCCTCTACATTACTAATGTTGGCATCCCCATCCTCTTCTTTACTGTCATGGGTGCTGCATTCCAGGAATTTTACCTTCATAGGTAACTGGGTAAAATCGAAGTCTTTGCCTTTCTTCCCAAGCTGTGCGACACCCGAGTTGCTACCTTCCAGGGTGGTAGGAGCAGCCGAGCGAGTGACACGAAGAGTGTTCAGCTCTTTCTCCAACTGCTGCTGTACAAGTTTGGCTGATTTGGCCATTGAAATATCTTGTTTATTGCAAGCAATGAGTATTGGTGGAGCATTCTTCAGTACTGCAACATCTGTCAATAGTTGGTAAAGGAGCTCAGCCACCTCTTTCACCTCACGCTGGAATGCTGAACTGTCCACTACAAACAGCAAGGCCCTTGCTGATGCTTTATATTGCTCCAGGAATTGATGCCTCANACTTTCGTGACCAGGAAGGTCAACAAGTGTCAAACTGGTCCCCTTGTCACTTTTCACTTTATATGCAGCAGAATTGGCAGTGATAGAGGGTTTGGGGTTTTCTTGTATGTTCCTGTAAGCAACCTGTTGAAAAGAAGGATTTTTTCCGGGAGTCACAGAAGCCCAACAAGCAGCACTGCCTCTCCCGCTGATCCAACTGCCTCTCAGAATTTTCCATAGAACAAAAGCTCAACAACACAACCATTCAGGGCCAATCCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACTAGCTTAGCCAGCCA