ORFeome > srsf2 ORF1 – XORFeome v1.0

srsf2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: srsf2
Gene ID: 481129
Gene Page ID: 481124
ORF Xenbase ID: 17298729

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045229
Original XGC clone length: 648

Human orthology & disease relationships

NCBI Entrez ID: 6427
Ensembl gene IDs: ENSG00000161547
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,609065,609227

Library Location

Plate ID: GDExl11013
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ824043
dbEST ID: 79641745
Trimmed Sequence: ATGAGCTACGGTCGGCCTCCGCCTGACGTGGAGGGAATGACCTCTCTCAAAGTTGATAACTTAACCTACCGAACCTCCCCGGAGACACTGCGCCGGGTGTTCGAGAAATACGGCAGGGTCGGCGATGTCTACATCCCAAGGGACCGCTACACTAAAGAGAGCCGGGGCTTCGCCTTCGTTCGCTTTCACGACAAGCGCGATGCCGAGGACGCGATGGACGCTATGGACGGGGCCGTGTTAGACGGGCGGGAGCTGAGGGTGCAGATGGCCCGCTACGGACGGCCGCCCGATTCCCATCACGGAAGGAGAGGACCTGCTCCTCGCAGATACGGCGACTACGGCCGGCGGAGTAGAAGTCCTAGGAGGCGTCGTCGCAGCCGTTCCAGGAGCAAGAGTAGGTCAAGGTCCCGTAGCAGGTCTCGCCACAGCCGCTCAAAGTCTCACTCTCGTACAAGGTCTCGTACTCGGTCCAGATCAAAGTCTCGCTCCGCAAGAAGATCTAAGTCAAAGTCATCGTCTGTGTCAAGGTCTCGCTCCAGATCTAGATCCAGAACAAGGAACTCGCCTCCTCCGCAGAACTCCAAATCAAGATCCCGCTCTAAGAGCCCTCCAAAATCCCCAGAGGAAGAGGGAGCAGTGTCTTCATT
Full Trace Sequence: GGTACCTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCTACGGTCGGCCTCCGCCTGACGTGGAGGGAATGACCTCTCTCAAAGTTGATAACTTAACCTACCGAACCTCCCCGGAGACACTGCGCCGGGTGTTCGAGAAATACGGCAGGGTCGGCGATGTCTACATCCCAAGGGACCGCTACACTAAAGAGAGCCGGGGCTTCGCCTTCGTTCGCTTTCACGACAAGCGCGATGCCGAGGACGCGATGGACGCTATGGACGGGGCCGTGTTAGACGGGCGGGAGCTGAGGGTGCAGATGGCCCGCTACGGACGGCCGCCCGATTCCCATCACGGAAGGAGAGGACCTGCTCCTCGCAGATACGGCGACTACGGCCGGCGGAGTAGAAGTCCTAGGAGGCGTCGTCGCAGCCGTTCCAGGAGCAAGAGTAGGTCAAGGTCCCGTAGCAGGTCTCGCCACAGCCGCTCAAAGTCTCACTCTCGTACAAGGTCTCGTACTCGGTCCAGATCAAAGTCTCGCTCCGCAAGAAGATCTAAGTCAAAGTCATCGTCTGTGTCAAGGTCTCGCTCCAGATCTAGATCCAGAACAAGGAACTCGCCTCCTCCGCAGAACTCCAAATCAAGATCCCGCTCTAAGAGCCCTCCAAAATCCCCAGAGGAAGAGGGAGCAGTGTCTTCATTGCCAACTTTCTTGTACAAAGTTTGGCTTTAATAGAAAGCATTGCTTTATCAATTTTGTTGCAACGAACAGGGTCACTTATCAGTCAAAAATAAAATCATTATTTTGCCATCCCAGCTGATTTCCCCCTAAAACTGGAGTCCAAATTACCTGGGTCCAATAACTGTTTTTCCCTGGGCAGCCTTTTGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTACGGTCGGCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829353
dbEST ID: 79647055
Trimmed Sequence: TGAAGACACTGCTCCCTCTTCCTCTGGGGATTTTGGAGGGCTCTTAGAGCGGGATCTTGATTTGGAGTTCTGCGGAGGAGGCGAGTTCCTTGTTCTGGATCTAGATCTGGAGCGAGACCTTGACACAGACGATGACTTTGACTTAGATCTTCTTGCGGAGCGAGACTTTGATCTGGACCGAGTACGAGACCTTGTACGAGAGTGAGACTTTGAGCGGCTGTGGCGAGACCTGCTACGGGACCTTGACCTACTCTTGCTCCTGGAACGGCTGCGACGACGCCTCCTAGGACTTCTACTCCGCCGGCCGTAGTCGCCGTATCTGCGAGGAGCAGGTCCTCTCCTTCCGTGATGGGAATCGGGCGGCCGTCCGTAGCGGGCCATCTGCACCCTCAGCTCCCGCCCGTCTAACACGGCCCCGTCCATAGCGTCCATCGCGTCCTCGGCATCGCGCTTGTCGTGAAAGCGAACGAAGGCGAAGCCCCGGCTCTCTTTAGTGTAGCGGTCCCTTGGGATGTAGACATCGCCGACCCTGCCGTATTTCTCGAACACCCGGCGCATTGTCTCCGGGGAGGTTCGGAAGGGTTAGTAATTAACTTTGAAAAAAGGTCTTCCCTCAACGTCGGGCGGAAGGCGACCGTAACTAAGGGTGGCAACTTTTTTGTAAAAGTGGGGGATTAAAAAAAACAATTGGGTCATAAATTTTTTGCAACCAACGGGGGTCCTTTTCAAGTCAAAATTAAAAATCAAAAAATTTGGGGGGGCACGAAA
Full Trace Sequence: GGCCACGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGAAGACACTGCTCCCTCTTCCTCTGGGGATTTTGGAGGGCTCTTAGAGCGGGATCTTGATTTGGAGTTCTGCGGAGGAGGCGAGTTCCTTGTTCTGGATCTAGATCTGGAGCGAGACCTTGACACAGACGATGACTTTGACTTAGATCTTCTTGCGGAGCGAGACTTTGATCTGGACCGAGTACGAGACCTTGTACGAGAGTGAGACTTTGAGCGGCTGTGGCGAGACCTGCTACGGGACCTTGACCTACTCTTGCTCCTGGAACGGCTGCGACGACGCCTCCTAGGACTTCTACTCCGCCGGCCGTAGTCGCCGTATCTGCGAGGAGCAGGTCCTCTCCTTCCGTGATGGGAATCGGGCGGCCGTCCGTAGCGGGCCATCTGCACCCTCAGCTCCCGCCCGTCTAACACGGCCCCGTCCATAGCGTCCATCGCGTCCTCGGCATCGCGCTTGTCGTGAAAGCGAACGAAGGCGAAGCCCCGGCTCTCTTTAGTGTAGCGGTCCCTTGGGATGTAGACATCGCCGACCCTGCCGTATTTCTCGAACACCCGGCGCATTGTCTCCGGGGAGGTTCGGAAGGGTTAGTAATTAACTTTGAAAAAAGGTCTTCCCTCAACGTCGGGCGGAAGGCGACCGTAACTAAGGGTGGCAACTTTTTTGTAAAAGTGGGGGATTAAAAAAAACAATTGGGTCATAAATTTTTTGCAACCAACGGGGGTCCTTTTCAAGTCAAAATTAAAAATCAAAAAATTTGGGGGGGCACGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAAGACACTGCTCCCTC