ORFeome > srsf3 ORF1 – XORFeome v1.0

srsf3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: srsf3
Gene ID: 490821
Gene Page ID: 490816
ORF Xenbase ID: 17298735

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046661
Original XGC clone length: 576

Human orthology & disease relationships

NCBI Entrez ID: 6428
Ensembl gene IDs: ENSG00000112081
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,154500,162210,164300,193520,214450,253300,253400,253550,256710,300590,303600,600334,603689,604145,608807,608808,609065,609227

Library Location

Plate ID: GDExl11010
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ823848
dbEST ID: 79641550
Trimmed Sequence: ATGCATCGTGACTCCTGTCCCTTAGACTGTAAAGTCTATGTTGGGAATCTTGGAAACAATGGCAACAAAACAGAATTAGAAAGAGCTTTTGGCTACTATGGACCTCTGCGCAGTGTGTGGGTTGCAAGGAATCCGCCAGGGTTTGCTTTTGTAGAGTTTGAAGATCTCCGTGATGCAGCAGATGCTGTTAGAGAGCTGGATGGAAGGACGCTTTGTGGGTGCCGAGTTAGGGTTGAATTATCCAATGGTGAGAAAAGAAGTAGAAACAGAGGACCCCCTCCTTCATGGAACAGGCGGCCCCGGGATGACCATCGTAGAAGAAGTCCACCACCAAGACGCAGGTACCTTATGCACTTCAGCAAATTTTATAATTGTTTATTGAAGTTAGGGTTACGTAGTGCAGCCTTCATTTATCAGTTGCATAGCTATTGGATATGTTGGTTCTCAAGCATCCCCCCCCCCTTTCCCTTTACAGAACCCATATGTCTTTGCTCGTTCAACCTACATGCAATAATCTTTGTTTACTTGGTGTTTTTTCGTACCTCCACACCCCAATTGGAGGAGAATCATTTGTT
Full Trace Sequence: CAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCATCGTGACTCCTGTCCCTTAGACTGTAAAGTCTATGTTGGGAATCTTGGAAACAATGGCAACAAAACAGAATTAGAAAGAGCTTTTGGCTACTATGGACCTCTGCGCAGTGTGTGGGTTGCAAGGAATCCGCCAGGGTTTGCTTTTGTAGAGTTTGAAGATCTCCGTGATGCAGCAGATGCTGTTAGAGAGCTGGATGGAAGGACGCTTTGTGGGTGCCGAGTTAGGGTTGAATTATCCAATGGTGAGAAAAGAAGTAGAAACAGAGGACCCCCTCCTTCATGGAACAGGCGGCCCCGGGATGACCATCGTAGAAGAAGTCCACCACCAAGACGCAGGTACCTTATGCACTTCAGCAAATTTTATAATTGTTTATTGAAGTTAGGGTTACGTAGTGCAGCCTTCATTTATCAGTTGCATAGCTATTGGATATGTTGGTTCTCAAGCATCCCCCCCCCCTTTCCCTTTACAGAACCCATATGTCTTTGCTCGTTCAACCTACATGCAATAATCTTTGTTTACTTGGTGTTTTTTCGTACCTCCACACCCCAATTGGAGGAGAATCATTTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACAGGGTCATAGCTGTTTCCGGGGCAACTCTGGGCGTGTCAAAACACAACCAAAAAAAAAAAAAAAAAAAANCCCCCCCNNNCGGGGGGGCCTGTCTGTTTTTTTTTTTTTTTTTTTTTGGGGGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATCGTGACTCCTGTCCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829156
dbEST ID: 79646858
Trimmed Sequence: CAAATGATTCTCCTCCAATTGGGGTGTGGAGGTACGAAAAAACACCAAGTAAACAAAGATTATTGCATGTAGGTTGAACGAGCAAAGACATATGGGTTCTGTAAAGGGAAAGGGGGGGGGGATGCTTGAGAACCAACATATCCAATAGCTATGCAACTGATAAATGAAGGCTGCACTACGTAACCCTAACTTCAATAAACAATTATAAAATTTGCTGAAGTGCATAAGGTACCTGCGTCTTGGTGGTGGACTTCTTCTACAATGGTCATCCCGGGGCCGCCTGTTCCATGAAGGAGGGGGTCCTCTGTTTCTACTTCTTTTCTCACCATTGGATAATTCAACCCTAACTCGGCACCCACAAAGCGTCCTTCCATCCAGCTCTCTAACAGCATCTGCTGCATCACGGAGATCTTCAAACTCTACAAAAGCAAACCCTGGCGGATTCCTTGCAACCCACACACTGCGCAGAGGTCCATATTACCCAAAAGCTCTTTCTAATTCTGTTTTGTTGCCATTGTTTCCAAGATTCCCAACATAGACGTTACAGTCTAAGGGACATGAGTCACGATGCATGG
Full Trace Sequence: GGGCACGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAATGATTCTCCTCCAATTGGGGTGTGGAGGTACGAAAAAACACCAAGTAAACAAAGATTATTGCATGTAGGTTGAACGAGCAAAGACATATGGGTTCTGTAAAGGGAAAGGGGGGGGGGATGCTTGAGAACCAACATATCCAATAGCTATGCAACTGATAAATGAAGGCTGCACTACGTAACCCTAACTTCAATAAACAATTATAAAATTTGCTGAAGTGCATAAGGTACCTGCGTCTTGGTGGTGGACTTCTTCTACAATGGTCATCCCGGGGCCGCCTGTTCCATGAAGGAGGGGGTCCTCTGTTTCTACTTCTTTTCTCACCATTGGATAATTCAACCCTAACTCGGCACCCACAAAGCGTCCTTCCATCCAGCTCTCTAACAGCATCTGCTGCATCACGGAGATCTTCAAACTCTACAAAAGCAAACCCTGGCGGATTCCTTGCAACCCACACACTGCGCAGAGGTCCATATTACCCAAAAGCTCTTTCTAATTCTGTTTTGTTGCCATTGTTTCCAAGATTCCCAACATAGACGTTACAGTCTAAGGGACATGAGTCACGATGCATGGTGCCAACTTTTTTGAACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCCACAATAAAATCCATTAAATATGGGAGCCCAAGCTTAAAACCGGGCGTCGTCCACGCACCCCCCGCCCACGCCGGGCGGCGGGGGNNCCCACAACAAAAAACACANCCCCCAAAAAAAAGGGGGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAATGATTCTCCTCCAATTGGG