ORFeome > srsf6 ORF1 – XORFeome v1.0

srsf6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: srsf6
Gene ID: 865817
Gene Page ID: 488900
ORF Xenbase ID: 17298753

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046668
Original XGC clone length: 2004

Human orthology & disease relationships

NCBI Entrez ID: 6431
Ensembl gene IDs: ENSG00000124193
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,609065,609227

Library Location

Plate ID: GDExl11011
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ823876
dbEST ID: 79641578
Trimmed Sequence: ATGCCGCGAGTGTACATCGGAAGACTCGGCTATCACGTACGAGAGAAGGATCTCCAGCGGTTCTTCGGGGGCTATGGCAAGCTACTAGAGATTGATCTAAAGAACGGGTACGGCTTTGTGGAATTTGAGGACTCGAGGGATGCTGATGATGCAGTGTATGAGCTAAATGGCAAAGATCTGTGTGGTGAGCGTGTGATTATAGAACATGCCCGGGGCCCACGGCGAGACCGAGATGGATACGGCTATGGAAGTCGCAGTGGATACAGAAACCAGAGAACTGGCAGGGACAAGTATGGTCCCCCCGTGCGCACAGAATTTAGACTTGTCGTGGAAAACCTCTCCAGTCGATGCAGCTGGCAAGATCTCAAGGATTTTATGAGGCAGGCGGGCGAGGTGACATACGCTGATGCCCATAAGGAGCGTGCCAATGAGGGGGTTATAGAGTTCAGGTCTTACTCTGATATGAAGAGAGCTGTGGAGAAGTTGGATGGCACAGAGATAAATGGACGCAGAATCCGGCTAGTGGAAGGAAAGACTCGTCACAGGAGGCCTTATTCTGGTAGCCACTCCAGATCACGAGCTCGTAGCAGGCGAAGATCGCGCAGCAGGAGTAGGCATCCTAGCCACAGCAGGTCCAGGAGTCAATCTCGTTCACCTGCCAAGAAAAGCCGGGTCTCGTTCCCTTGCAAGGAGCAGCCATTCACAGTCACCTGGAAAGAGCCAGTCCCGGTCTAGATCAAGAACCCGAAAGTAAAGAAAGGGTCAAGCAAGCCAAAGTCTTTGCATTGGGTCCAAATCCCGTAACCTATTTCCCAGGAAAAAAAGGAAAGAATTTCCA
Full Trace Sequence: TAATGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGCGAGTGTACATCGGAAGACTCGGCTATCACGTACGAGAGAAGGATCTCCAGCGGTTCTTCGGGGGCTATGGCAAGCTACTAGAGATTGATCTAAAGAACGGGTACGGCTTTGTGGAATTTGAGGACTCGAGGGATGCTGATGATGCAGTGTATGAGCTAAATGGCAAAGATCTGTGTGGTGAGCGTGTGATTATAGAACATGCCCGGGGCCCACGGCGAGACCGAGATGGATACGGCTATGGAAGTCGCAGTGGATACAGAAACCAGAGAACTGGCAGGGACAAGTATGGTCCCCCCGTGCGCACAGAATTTAGACTTGTCGTGGAAAACCTCTCCAGTCGATGCAGCTGGCAAGATCTCAAGGATTTTATGAGGCAGGCGGGCGAGGTGACATACGCTGATGCCCATAAGGAGCGTGCCAATGAGGGGGTTATAGAGTTCAGGTCTTACTCTGATATGAAGAGAGCTGTGGAGAAGTTGGATGGCACAGAGATAAATGGACGCAGAATCCGGCTAGTGGAAGGAAAGACTCGTCACAGGAGGCCTTATTCTGGTAGCCACTCCAGATCACGAGCTCGTAGCAGGCGAAGATCGCGCAGCAGGAGTAGGCATCCTAGCCACAGCAGGTCCAGGAGTCAATCTCGTTCACCTGCCAAGAAAAGCCGGGTCTCGTTCCCTTGCAAGGAGCAGCCATTCACAGTCACCTGGAAAGAGCCAGTCCCGGTCTAGATCAAGAACCCGAAAGTAAAGAAAGGGTCAAGCAAGCCAAAGTCTTTGCATTGGGTCCAAATCCCGTAACCTATTTCCCAGGAAAAAAAGGAAAGAATTTCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGCGAGTGTACATCGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829182
dbEST ID: 79646884
Trimmed Sequence: TTCTCGAGAACTAGAGCGAGACCTAGAACTGGAAGCAGAAGCAGCTCGAGGAAGAGGGCTGAGAGACCGCTCCTTGCTACTAGAAGCTGGAAGAGGAGACTGGGAGCGGGATCGTGCACCTCCCTTTCCATTCTGCTGTGGAGAATGGGATCCGGAACGACTGCGAGTAGACCTTGCCTTCTTTGCATTGGGACGACCTTCAGAATTACCCCTTTTGCCTTTGGAACGACTGCGTGATCTCTCTCTTTTGCCTTTGGAATGGCTGTGGGATCTTTCCCGCTTGCTCTTTGATCTACTACGGGATCTTTCCCACTTGGATTTTGAGCGACTACTTGACCTTTCCCGCTTGGATTTTGAGCGACTACTTGACCTTTCCCGCTTGGATTGTGAGCGACTGCTTGACCTTTCCCGCTTGGATTTTGAGCGACTACTTGACCTTTCCCGCTTGGATTTTGACCGACTGTTAGACCTTTCTTGCTTGCTTGTTGACCTGCTACCAGACCTATCACGCTTGCTCTTCGACCGGCTGCCAGACATCTCATGCTTGCCTTGGCTACGAGATCTGTCATGCTTGCTTTTTGATGGACTGCGCGATCTTTCCCTGTTCTCTCTGGGACGGACGGAGCGACATTTCATCTTTTGACCGACTGCGAGATCCTTTCACCCTTAGCATTGGGATCGGCCGGCAAGACCTGGCC
Full Trace Sequence: TGACGTGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTCGAGAACTAGAGCGAGACCTAGAACTGGAAGCAGAAGCAGCTCGAGGAAGAGGGCTGAGAGACCGCTCCTTGCTACTAGAAGCTGGAAGAGGAGACTGGGAGCGGGATCGTGCACCTCCCTTTCCATTCTGCTGTGGAGAATGGGATCCGGAACGACTGCGAGTAGACCTTGCCTTCTTTGCATTGGGACGACCTTCAGAATTACCCCTTTTGCCTTTGGAACGACTGCGTGATCTCTCTCTTTTGCCTTTGGAATGGCTGTGGGATCTTTCCCGCTTGCTCTTTGATCTACTACGGGATCTTTCCCACTTGGATTTTGAGCGACTACTTGACCTTTCCCGCTTGGATTTTGAGCGACTACTTGACCTTTCCCGCTTGGATTGTGAGCGACTGCTTGACCTTTCCCGCTTGGATTTTGAGCGACTACTTGACCTTTCCCGCTTGGATTTTGACCGACTGTTAGACCTTTCTTGCTTGCTTGTTGACCTGCTACCAGACCTATCACGCTTGCTCTTCGACCGGCTGCCAGACATCTCATGCTTGCCTTGGCTACGAGATCTGTCATGCTTGCTTTTTGATGGACTGCGCGATCTTTCCCTGTTCTCTCTGGGACGGACGGAGCGACATTTCATCTTTTGACCGACTGCGAGATCCTTTCACCCTTAGCATTGGGATCGGCCGGCAAGACCTGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTCGAGAACTAGAGCGAGAC