ORFeome > ssbp1 ORF1 – XORFeome v1.0

ssbp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ssbp1
Gene ID: 979715
Gene Page ID: 979708
ORF Xenbase ID: 17298801

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133265
Original XGC clone length: 447

Human orthology & disease relationships

NCBI Entrez ID: 6742
Ensembl gene IDs: ENSG00000106028
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 231900,266130,273750

Library Location

Plate ID: GDExl11006
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ840213
dbEST ID: 79657915
Trimmed Sequence: ATGTTTCATCGGCCGGTCCTTCAGGTGTTTCGCCAGTTTGCAAGATGTCAGTCCACGGACTCCCTGTCTGCCATACTGGAGCGATCGATGAATAAAGTGCAGCTCTTGGGCAGAGTCGGGCAGGACCCGGTCATGAGACAAGCGGACGGGAAGAATCCAGTGACCATCTTCTCTCTGGCAACCAATGAGCTGTGGAGATCAGGGGAAAACGAGGTGTTCCAGCCAGCTGGAGACGTGAACCAGAAAACCACGTGGCACAGGGTATCCGTGTTCCGACCTGGGCTCCGGGATGTGGCCTATCAGCACGTGAAGAAGGGAGCACGGCTATTGGTAGAAGGAAAGATTGACTATGGGGAATATACAGACAAGAACAACGTGAGGAGACAAGCGACCACCATCATAGCAGATAACATCATATTCCTCACTGACCTCCGGGACAAGCCGTT
Full Trace Sequence: GGGGCTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTCATCGGCCGGTCCTTCAGGTGTTTCGCCAGTTTGCAAGATGTCAGTCCACGGACTCCCTGTCTGCCATACTGGAGCGATCGATGAATAAAGTGCAGCTCTTGGGCAGAGTCGGGCAGGACCCGGTCATGAGACAAGCGGACGGGAAGAATCCAGTGACCATCTTCTCTCTGGCAACCAATGAGCTGTGGAGATCAGGGGAAAACGAGGTGTTCCAGCCAGCTGGAGACGTGAACCAGAAAACCACGTGGCACAGGGTATCCGTGTTCCGACCTGGGCTCCGGGATGTGGCCTATCAGCACGTGAAGAAGGGAGCACGGCTATTGGTAGAAGGAAAGATTGACTATGGGGAATATACAGACAAGAACAACGTGAGGAGACAAGCGACCACCATCATAGCAGATAACATCATATTCCTCACTGACCTCCGGGACAAGCCGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCAGAAAAATCAGGACAATGTATCAAATCAAGTAAGGTTAACACGGCGGGGCGGGAAAGCCCCGGAGATCTAATTCCCCAAAGGGGGCGGGGGGAAATCAACGTTGGCTTGAGATTAAAAAACCGGCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTCATCGGCCGGTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ840212
dbEST ID: 79657914
Trimmed Sequence: CGGCTTGTCCCGGAGGTCAGTGAGGAATATGATGTTATCTGCTATGATGGTGGTCGCTTGTCTCCTCACGTTGTTCTTGTCTGTATATTCCCCATAGTCAATCTTTCCTTCTACCAATAGCCGTGCTCCCTTCTTCACGTGCTGATAGGCCACATCCCGGAGCCCAGGTCGGAACACGGATACCCTGTGCCACGTGGTTTTCTGGTTCACGTCTCCNGCTGGCTGGAACACCTCGTTTTCCCCTGATCTCCACAGCTCATTGGTTGCCAGAGAGAAGATGGTCACTGGATTCTTCCCGTCCGCTTGTCTCATGACCGGGTCCTGCCCGACTCTGCCCAAGAGCTGCACTTTATTCATCGATCGCTCCAGTATGGCAGACAGGGAGTCCGTGGACTGACATCTTGCAAACTGGCGAAACACCTGAAGGACCGGCCGATGAAACATGG
Full Trace Sequence: GACGGGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGGCTTGTCCCGGAGGTCAGTGAGGAATATGATGTTATCTGCTATGATGGTGGTCGCTTGTCTCCTCACGTTGTTCTTGTCTGTATATTCCCCATAGTCAATCTTTCCTTCTACCAATAGCCGTGCTCCCTTCTTCACGTGCTGATAGGCCACATCCCGGAGCCCAGGTCGGAACACGGATACCCTGTGCCACGTGGTTTTCTGGTTCACGTCTCCNGCTGGCTGGAACACCTCGTTTTCCCCTGATCTCCACAGCTCATTGGTTGCCAGAGAGAAGATGGTCACTGGATTCTTCCCGTCCGCTTGTCTCATGACCGGGTCCTGCCCGACTCTGCCCAAGAGCTGCACTTTATTCATCGATCGCTCCAGTATGGCAGACAGGGAGTCCGTGGACTGACATCTTGCAAACTGGCGAAACACCTGAAGGACCGGCCGATGAAACATGGTGCCTACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCAAAGCATAAAAATGGAGCATCATTTTACACCTCCTTGGAACTGGGCGGGGCCAAAGGCCCAAATGGCCGGCCGAAAAGGGGGGCGGGGGTTTTTCTGTGGATTGCGGGGAGAGCTCCCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGGCTTGTCCCGGAGGT