ORFeome > ssbp2 ORF1 – XORFeome v1.0

ssbp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ssbp2
Gene ID: 987290
Gene Page ID: 987285
ORF Xenbase ID: 17298813

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042259
Original XGC clone length: 1080

Human orthology & disease relationships

NCBI Entrez ID: 23635
Ensembl gene IDs: ENSG00000145687
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 145500,203450,245349,252010,256000,607322

Library Location

Plate ID: GDExl11016
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ824282
dbEST ID: 79641984
Trimmed Sequence: ATGTACGCCAAAGGCAAGAGTAACAGCGTACCGTCCGACAGCCAGGCCAGGGAGAAGTTAGCATTGTATGTATATGAATACCTGCTGCACGTTGGCGCACAGAAGTCTGCCCAGACATTTTTGTCAGAGATAAGATGGGAAAAAAATATCACACTGGGAGAACCCCCTGGATTCTTACATTCTTGGTGGTGTGTATTTTGGGATCTGTACTGCGCGGCACCAGAGAGACGGGAAACCTGTGAACATTCGAGTGAAGCAAAAGCCTTCCATGATTATAGTGCTGCAGCTGCCCCTAGTCCAGTTCTTGGAAACATGCCTCCAGGGGATGGAATGCCAGTGGGCCCAGTTCCTCCAGGCTTCTTCCAGCCATTTATGTCTCCCCGGTATCCTGGTGGTCCCAGGCCCCCCTTAAGAATACCTAACCAGGGACTGGCTGGTGTTCCTGGAAGTCAAACATTACTTCCTAGTGGAATGGACCCATCAAGGCAACAAGGACATCCAAACATGGCTGGGCCCATGCAGAGAATGAGTGGTCCGAGAGGAATGGTTCCTTTAGGCCCACAGAGTTATGGAGGGGGAATGAGACCGCCACTGAATGCACTTGGTGGCCCAGGGATGCCGGGAATGAACATGGGTCCCGGAGGTGGCAGGCCATGGCCCAATCCAGGCAATGCTAATTCGATACCCTACTCATCTGTGTCTCCGGGGAATTACGTGGGTCCNTCGGGGNAGGTGGAGGTCCGCCAGGAAACCCCAATCATGCCCAAGCCCAGCAGATTTCAACAATTCCTGGGAGAATAACATGTACCCCTTTTATTGGA
Full Trace Sequence: GGCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTACGCCAAAGGCAAGAGTAACAGCGTACCGTCCGACAGCCAGGCCAGGGAGAAGTTAGCATTGTATGTATATGAATACCTGCTGCACGTTGGCGCACAGAAGTCTGCCCAGACATTTTTGTCAGAGATAAGATGGGAAAAAAATATCACACTGGGAGAACCCCCTGGATTCTTACATTCTTGGTGGTGTGTATTTTGGGATCTGTACTGCGCGGCACCAGAGAGACGGGAAACCTGTGAACATTCGAGTGAAGCAAAAGCCTTCCATGATTATAGTGCTGCAGCTGCCCCTAGTCCAGTTCTTGGAAACATGCCTCCAGGGGATGGAATGCCAGTGGGCCCAGTTCCTCCAGGCTTCTTCCAGCCATTTATGTCTCCCCGGTATCCTGGTGGTCCCAGGCCCCCCTTAAGAATACCTAACCAGGGACTGGCTGGTGTTCCTGGAAGTCAAACATTACTTCCTAGTGGAATGGACCCATCAAGGCAACAAGGACATCCAAACATGGCTGGGCCCATGCAGAGAATGAGTGGTCCGAGAGGAATGGTTCCTTTAGGCCCACAGAGTTATGGAGGGGGAATGAGACCGCCACTGAATGCACTTGGTGGCCCAGGGATGCCGGGAATGAACATGGGTCCCGGAGGTGGCAGGCCATGGCCCAATCCAGGCAATGCTAATTCGATACCCTACTCATCTGTGTCTCCGGGGAATTACGTGGGTCCNTCGGGGNAGGTGGAGGTCCGCCAGGAAACCCCAATCATGCCCAAGCCCAGCAGATTTCAACAATTCCTGGGAGAATAACATGTACCCCTTTTATTGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACGCCAAAGGCAAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829619
dbEST ID: 79647321
Trimmed Sequence: CACGCTCATTGTCATGCTAGGAGAATAACTCTCATTCTGAAAGGGGTTTAAGAAATTTCCACCCATTTCTCCATCATCCCTTGGTGTGCCTGGCTGGTTACTCAGATTCATGTTATTGGGAGAGTTCTTTGAAATACTGTCCATGTCCCCTGAACCTAGTGAGCCATTTATGTGGTGTGGTTCCATTCCACCCAATCCACTCATTGGGCCATCTGAGCCGGGACCCATTGGAAAATTAGGCCTGTTGCCTCCCGGAGGAACTGCATTCATTAAAGTGTACATGTTATCTCCAGAATTTGTGGAATCTGCTGGGCTTGGCATGATTGGGGTTCCTGGCGGACCTCCACCTCCCGGAGGACCCACGTAATTCCCGGGAGACACAGATGAGTAGGGTATCGAATTAGCATTGCCTGGATTGGGCCATGGCCTGCCACCTCCGGGACCCATGTTCATTCCCGGCATCCCTGGGCCACCAAGTGCATTCAGTGGCGGTCTCATTCCCCCTCCATAACTCTGTGGGCCTAAAGGAACCATTCCTCTCGGACCACTCATTCTCTGCATGGGCCCAGCCATGTTTGGATGTCCTTGTTGCCTTGATGGGTCATTCCACTAGGAAGTAATGTTTGACTTCCAGGAACACCAGCCAGTCCCCTGGTTAGGTATTCTTTAGGGGGGGGCCTGGGACCACCCGGGATACCGGGGGAGAACTAAAATGGCCTGGAAAAAAGACCCGGGAGGAAACTTGGGGCCCCCCGGGGGATTCTCCTTC
Full Trace Sequence: CCGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACGCTCATTGTCATGCTAGGAGAATAACTCTCATTCTGAAAGGGGTTTAAGAAATTTCCACCCATTTCTCCATCATCCCTTGGTGTGCCTGGCTGGTTACTCAGATTCATGTTATTGGGAGAGTTCTTTGAAATACTGTCCATGTCCCCTGAACCTAGTGAGCCATTTATGTGGTGTGGTTCCATTCCACCCAATCCACTCATTGGGCCATCTGAGCCGGGACCCATTGGAAAATTAGGCCTGTTGCCTCCCGGAGGAACTGCATTCATTAAAGTGTACATGTTATCTCCAGAATTTGTGGAATCTGCTGGGCTTGGCATGATTGGGGTTCCTGGCGGACCTCCACCTCCCGGAGGACCCACGTAATTCCCGGGAGACACAGATGAGTAGGGTATCGAATTAGCATTGCCTGGATTGGGCCATGGCCTGCCACCTCCGGGACCCATGTTCATTCCCGGCATCCCTGGGCCACCAAGTGCATTCAGTGGCGGTCTCATTCCCCCTCCATAACTCTGTGGGCCTAAAGGAACCATTCCTCTCGGACCACTCATTCTCTGCATGGGCCCAGCCATGTTTGGATGTCCTTGTTGCCTTGATGGGTCATTCCACTAGGAAGTAATGTTTGACTTCCAGGAACACCAGCCAGTCCCCTGGTTAGGTATTCTTTAGGGGGGGGCCTGGGACCACCCGGGATACCGGGGGAGAACTAAAATGGCCTGGAAAAAAGACCCGGGAGGAAACTTGGGGCCCCCCGGGGGATTCTCCTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACGCTCATTGTCATGCT