ORFeome > ssbp4 ORF1 – XORFeome v1.0

ssbp4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ssbp4
Gene ID: 994794
Gene Page ID: 994792
ORF Xenbase ID: 17298831

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045092
Original XGC clone length: 1164

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ824069
dbEST ID: 79641771
Trimmed Sequence: ATGTATGCCAAAGGGAAAGGATCCACTGTCCCCTCTGATAGCCAGGCCAGGGAAAAGTTAGCTTTATATGTGTATGAATATTTACTACATGTAGGAGCTCAGAAATCTGCACAGACATTCCTGTCAGAGATACGATGGGAGAAAAATATCACATTAGGAGAACCTCCTGGGTTTTTACACTCCTGGTGGTGTGTATTCTGGGATCTGTATTGTGCTGCCCCCGACAGACGTGAAACATGTGAGCACTCCAGTGAAGCCAAGGCGTTCCATGACTATAGTGCGGCTGCTGCTCCCAGTCCAGTGATGGGTAACATGCCTCCCAATGATGGAATACCAGGTGGACCCATGCCTCCAGGATTCTTTCAGGGACCTCCAGGCTCACAGCCATCACCTCACGCACAGCCTCCTCCACACAACCCCAACAACCCTATGATGGGTCCTCACAGTCAGCCCTTCATGTCCCCACGGTATCCAGGTGGCCCAAGACCTTCCCTCAGAATGCCAAATCAGCCTCCTGTTGGGGTTCCAGGTTCACAGCCTTTGCTGCCAAACTCTATGGATCCGACACGGCCACAGGGACATCCAAACATGGGGGGCCCTATGCAGAGAATGAACCCACCACGGGGCATGGGAGCAATGGGACCACAGAATTATGGCAGTGGGATGAGGCCTCCTCCAACTCATTAGGTGGTCCTGGCATGCCTGGGATGAATATGGGTCCAGGAAGAAGGGGTCCTTGGGCCAATTCCAAATGCTAACTTCGATAACGTAATTCATCATCCTTCACCAGGAAAATTATGTGGGGCCCCCCCGGGGGAAGGTGGGGGGTTCCTCCC
Full Trace Sequence: TAATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTATGCCAAAGGGAAAGGATCCACTGTCCCCTCTGATAGCCAGGCCAGGGAAAAGTTAGCTTTATATGTGTATGAATATTTACTACATGTAGGAGCTCAGAAATCTGCACAGACATTCCTGTCAGAGATACGATGGGAGAAAAATATCACATTAGGAGAACCTCCTGGGTTTTTACACTCCTGGTGGTGTGTATTCTGGGATCTGTATTGTGCTGCCCCCGACAGACGTGAAACATGTGAGCACTCCAGTGAAGCCAAGGCGTTCCATGACTATAGTGCGGCTGCTGCTCCCAGTCCAGTGATGGGTAACATGCCTCCCAATGATGGAATACCAGGTGGACCCATGCCTCCAGGATTCTTTCAGGGACCTCCAGGCTCACAGCCATCACCTCACGCACAGCCTCCTCCACACAACCCCAACAACCCTATGATGGGTCCTCACAGTCAGCCCTTCATGTCCCCACGGTATCCAGGTGGCCCAAGACCTTCCCTCAGAATGCCAAATCAGCCTCCTGTTGGGGTTCCAGGTTCACAGCCTTTGCTGCCAAACTCTATGGATCCGACACGGCCACAGGGACATCCAAACATGGGGGGCCCTATGCAGAGAATGAACCCACCACGGGGCATGGGAGCAATGGGACCACAGAATTATGGCAGTGGGATGAGGCCTCCTCCAACTCATTAGGTGGTCCTGGCATGCCTGGGATGAATATGGGTCCAGGAAGAAGGGGTCCTTGGGCCAATTCCAAATGCTAACTTCGATAACGTAATTCATCATCCTTCACCAGGAAAATTATGTGGGGCCCCCCCGGGGGAAGGTGGGGGGTTCCTCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATGCCAAAGGGAAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829377
dbEST ID: 79647079
Trimmed Sequence: CACGCTCATGGTCATGCTGGGTGAATAGCTTTCACTTTGGAAGGGGTTTAAAAAGTTCCCAGCCATCTCTCCATCGTCTCGAGGTGTCCCTGGAGGGTTATTCATTCCTGCCATATTATTTGGAGAGTTCTTTGGCAACACATCCATGTCCCCGGAGCCTAGAGATCCATTCATATGATGAGGTTCCATAGCTCCCATTCCTCCCATGGGACCATCAGGGCCAGGGCCCATTGGGAAGTTAGGTCTACTCCCGCCAGGTCCAATAGGGTTCATCATAGTGTACATGTTTTCACTAGAATTTGTAGAGTCTCCAGGGCTTGGCATGATAGGGGTTCCTGGAGGACCACCACCTCCCGGAGGACCCACATAGTTTCCTGGTGAGGATGATGAATACGCTATCGAGTTAGCATTTGGATTTGGCCAAGGACCCCTTCCTCCTGGACCCATATTCATCCCAGGCATGCCAGGACCACCTAATGAGTTTGGAGGAGGCCTCATCCCACTGCCATAATTCTGTGGTCCCATTGCTCCCATGCCCCGTGGTGGGTTCATTCTCTGCATAGGGCCCCCCCTGTTTGGATGTCCCTGGTGGCCGTGTCGGATCCATAGAGTTTGGCAGCAAAGGCTGTTAAACCGGGGAACCCCACCAGGAAGCTGAATTTGCATTCCTGAAGGGAAGGCCTTGGGGCCCACCCGGGATAACCGGGGGGGACCATGAAGGGGGCTTAACTGGGTAAGGGACCCCATTTCAAAAG
Full Trace Sequence: GACGGGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACGCTCATGGTCATGCTGGGTGAATAGCTTTCACTTTGGAAGGGGTTTAAAAAGTTCCCAGCCATCTCTCCATCGTCTCGAGGTGTCCCTGGAGGGTTATTCATTCCTGCCATATTATTTGGAGAGTTCTTTGGCAACACATCCATGTCCCCGGAGCCTAGAGATCCATTCATATGATGAGGTTCCATAGCTCCCATTCCTCCCATGGGACCATCAGGGCCAGGGCCCATTGGGAAGTTAGGTCTACTCCCGCCAGGTCCAATAGGGTTCATCATAGTGTACATGTTTTCACTAGAATTTGTAGAGTCTCCAGGGCTTGGCATGATAGGGGTTCCTGGAGGACCACCACCTCCCGGAGGACCCACATAGTTTCCTGGTGAGGATGATGAATACGCTATCGAGTTAGCATTTGGATTTGGCCAAGGACCCCTTCCTCCTGGACCCATATTCATCCCAGGCATGCCAGGACCACCTAATGAGTTTGGAGGAGGCCTCATCCCACTGCCATAATTCTGTGGTCCCATTGCTCCCATGCCCCGTGGTGGGTTCATTCTCTGCATAGGGCCCCCCCTGTTTGGATGTCCCTGGTGGCCGTGTCGGATCCATAGAGTTTGGCAGCAAAGGCTGTTAAACCGGGGAACCCCACCAGGAAGCTGAATTTGCATTCCTGAAGGGAAGGCCTTGGGGCCCACCCGGGATAACCGGGGGGGACCATGAAGGGGGCTTAACTGGGTAAGGGACCCCATTTCAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACGCTCATGGTCATGCT