ORFeome > ssh2 ORF1 – XORFeome v1.0

ssh2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ssh2
Gene ID: 6252803
Gene Page ID: 993092
ORF Xenbase ID: 17298837

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123130
Original XGC clone length: 495

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ838036
dbEST ID: 79655738
Trimmed Sequence: ATGGCTTTGGTTACAGTGCAGAGATCCCCCACCCCCAGCACCACCTCCAGCCCCTGCGTGTCGGAGGCAGACAGCGGAGAAGAAGAATGTCGTTCCCAGCCCCGGAGCATTAGTGAAAGTTTCCTGACGGTAAAAGGTGCTGCTCTCTTCCTCCCACGAGGAAATGGATCATCCACGCCGAGAATCAGCCACAGACGCAACAAACATGCAGGGGACTTGCAGCAGCACTTGCAGGCTATGTTTACACTCCTCCGACCTGAGGACAACATCCGGTTGAGGAATGTTGAAATGCCTTTCTGTGCAACAATTCAACTTATGGTGAAACGGAACAAATCGACTGTGAATGTGGAGCTGTTTACTTCAGATGATGACGGCTGGAACCAAAGTCTCATGCTATTAACTTGGATAAGATGTTGTGGACGTGGAGTCACAGGCTGCAGTAAATCCCTCGAAGTCAGAATTTTGTGCAAAGAGCAAGTGCCCATAATGTACTT
Full Trace Sequence: CTCGCGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTTGGTTACAGTGCAGAGATCCCCCACCCCCAGCACCACCTCCAGCCCCTGCGTGTCGGAGGCAGACAGCGGAGAAGAAGAATGTCGTTCCCAGCCCCGGAGCATTAGTGAAAGTTTCCTGACGGTAAAAGGTGCTGCTCTCTTCCTCCCACGAGGAAATGGATCATCCACGCCGAGAATCAGCCACAGACGCAACAAACATGCAGGGGACTTGCAGCAGCACTTGCAGGCTATGTTTACACTCCTCCGACCTGAGGACAACATCCGGTTGAGGAATGTTGAAATGCCTTTCTGTGCAACAATTCAACTTATGGTGAAACGGAACAAATCGACTGTGAATGTGGAGCTGTTTACTTCAGATGATGACGGCTGGAACCAAAGTCTCATGCTATTAACTTGGATAAGATGTTGTGGACGTGGAGTCACAGGCTGCAGTAAATCCCTCGAAGTCAGAATTTTGTGCAAAGAGCAAGTGCCCATAATGTACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAATCGTAATACTTGGTCATAGCTGTTAAATAAAAAATATGAACAATGTCTTCAATCTTCTTATGTTACCAGGGGGGGAAAAAAACCAAAACGTCGTTCCCCACAGGTGGGCGGGGGTGGGCTTTTGGGGGTTTTGGGGTGGGGGGGGCACCCAGCCGGGAAAAACAACCCCGGGGGGGGGGTGGGGGTGGTGTTTGGGGTGAGGTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTGGTTACAGTGCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838035
dbEST ID: 79655737
Trimmed Sequence: GTACATTATGGGCACTTGCTCTTTGCACAAAATTCTGACTTCGAGGGATTTACTGCAGCCTGTGACTCCACGTCCACAACATCTTATCCAAGTTAATAGCATGAGACTTTGGTTCCAGCCGTCATCATCTGAAGTAAACAGCTCCACATTCACAGTCGATTTGTTCCGTTTCACCATAAGTTGAATTGTTGCACAGAAAGGCATTTCAACATTCCTCAACCGGATGTTGTCCTCAGGTCGGAGGAGTGTAAACATAGCCTGCAAGTGCTGCTGCAAGTCCCCTGCATGTTTGTTGCGTCTGTGGCTGATTCTCGGCGTGGATGATCCATTTCCTCGTGGGAGGAAGAGAGCAGCACCTTTTACCGTCAGGAAACTTTCACTAATGCTCCGGGGCTGGGAACGACATTCTTCTTCTCCGCTGTCTGCCTCCGACACACAGGGGCTGGAGGTGGTGCTGGGGGTGGGGGATCACTGCACTCGGACGCAAACCGTAGTGCCGGCTTTCCTTTTACATGGTGGGGTTAAGAAAAAACAATGCTCGTCGGTTTTTTTCCAGCGAACAAATCACTAGGGGTCAAGGCGAGGNTCNNTNNAAAAAAAAAAAAAAAAAAAAAAAAAATATATTTTCTCTCTTCCGTTAGAACGGCGGGGGAAAAAAAAAACCTTACTGTCTCCCCCGAGGGGGGGGGGGGGTTTTGTCGTTGTGGGGGTGGAGGGGGGCCACCCCGGGAGAAAACAAACCTCCGGCGGTGGTGGGGTTTAATGGGAAAAAAAAAAA
Full Trace Sequence: AAACTGTCTATTGACGCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTACATTATGGGCACTTGCTCTTTGCACAAAATTCTGACTTCGAGGGATTTACTGCAGCCTGTGACTCCACGTCCACAACATCTTATCCAAGTTAATAGCATGAGACTTTGGTTCCAGCCGTCATCATCTGAAGTAAACAGCTCCACATTCACAGTCGATTTGTTCCGTTTCACCATAAGTTGAATTGTTGCACAGAAAGGCATTTCAACATTCCTCAACCGGATGTTGTCCTCAGGTCGGAGGAGTGTAAACATAGCCTGCAAGTGCTGCTGCAAGTCCCCTGCATGTTTGTTGCGTCTGTGGCTGATTCTCGGCGTGGATGATCCATTTCCTCGTGGGAGGAAGAGAGCAGCACCTTTTACCGTCAGGAAACTTTCACTAATGCTCCGGGGCTGGGAACGACATTCTTCTTCTCCGCTGTCTGCCTCCGACACACAGGGGCTGGAGGTGGTGCTGGGGGTGGGGGATCACTGCACTCGGACGCAAACCGTAGTGCCGGCTTTCCTTTTACATGGTGGGGTTAAGAAAAAACAATGCTCGTCGGTTTTTTTCCAGCGAACAAATCACTAGGGGTCAAGGCGAGGNTCNNTNNAAAAAAAAAAAAAAAAAAAAAAAAAATATATTTTCTCTCTTCCGTTAGAACGGCGGGGGAAAAAAAAAACCTTACTGTCTCCCCCGAGGGGGGGGGGGGGTTTTGTCGTTGTGGGGGTGGAGGGGGGCCACCCCGGGAGAAAACAAACCTCCGGCGGTGGTGGGGTTTAATGGGAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACATTATGGGCACTTGCT