ORFeome > ssr1 ORF1 – XORFeome v1.0

ssr1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ssr1
Gene ID: 492170
Gene Page ID: 492165
ORF Xenbase ID: 17298855

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056853
Original XGC clone length: 861

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ839539
dbEST ID: 79657241
Trimmed Sequence: ATGACCCCCCTCCGTAATCTGTTCCTGCTCGTCCTCCTGGCCTTCCCGATCACGCTCATCGGCAACAGCAAAGGTCCTCTAGTTGCTGCCCAAGATGCCACGGAAGATGAAGAGGCAATTGATGATTCTGTAGTAGAGGAGGATGATGATGAAGCTGAAGTTGAGGAGGATGATACAACAGACCTGACAGAAGAAAAAGAGGAAGAGGAAGACTTAAGTTCTGGAGAGCCCAAAGCTTCCCCCAATGCTGATACCACTATTCTTTTTGTAAAAGGCGAAGATTTCCCAGCAAATGATATTGTTAAGTTCTTGGTGGGCTTTACCAACAAGGGGCCTGAAAACTTCATCGTTGAATCACTGGATGCCTCATTCAGATACCCTCAGGACTACCAGTTCTACATTCAGAATTTTACAGCTCTGCCTTTAAACACGGTTGTCCCCCCACAAAAACAGGCCACATTTGAGTATTCCTTCATTCCTGCTGAGCCCATGGGAGGACGTCCTTTTGGACTTGTCATCAATTTGAACTATAAAGACGCANATGGAAATGCTTTCCAAGATGCTGTCTTCAATCAGACAGTTACTATCATTGAGAAAGAGGATGGTCTGGATGGAGAAACGATATTCATGTACATNGTTCCTTGGTGGGNCTGGGATTGCTTGGTGATTGTTGGGTCTGCATCAGCTGCTTGGATCCAGAAAGAGAAAAAGACAAGCTCAAAAAAGTGGAAAATGGGCACTTTCTACCCAAAATGAATGTGGAAAATGAAGTTTGGAATTCCCCCTGTGAAACTTTTAAACCCAAATCAATAAAGGGCTTTCCCCAAAGAA
Full Trace Sequence: GGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCCCCCTCCGTAATCTGTTCCTGCTCGTCCTCCTGGCCTTCCCGATCACGCTCATCGGCAACAGCAAAGGTCCTCTAGTTGCTGCCCAAGATGCCACGGAAGATGAAGAGGCAATTGATGATTCTGTAGTAGAGGAGGATGATGATGAAGCTGAAGTTGAGGAGGATGATACAACAGACCTGACAGAAGAAAAAGAGGAAGAGGAAGACTTAAGTTCTGGAGAGCCCAAAGCTTCCCCCAATGCTGATACCACTATTCTTTTTGTAAAAGGCGAAGATTTCCCAGCAAATGATATTGTTAAGTTCTTGGTGGGCTTTACCAACAAGGGGCCTGAAAACTTCATCGTTGAATCACTGGATGCCTCATTCAGATACCCTCAGGACTACCAGTTCTACATTCAGAATTTTACAGCTCTGCCTTTAAACACGGTTGTCCCCCCACAAAAACAGGCCACATTTGAGTATTCCTTCATTCCTGCTGAGCCCATGGGAGGACGTCCTTTTGGACTTGTCATCAATTTGAACTATAAAGACGCANATGGAAATGCTTTCCAAGATGCTGTCTTCAATCAGACAGTTACTATCATTGAGAAAGAGGATGGTCTGGATGGAGAAACGATATTCATGTACATNGTTCCTTGGTGGGNCTGGGATTGCTTGGTGATTGTTGGGTCTGCATCAGCTGCTTGGATCCAGAAAGAGAAAAAGACAAGCTCAAAAAAGTGGAAAATGGGCACTTTCTACCCAAAATGAATGTGGAAAATGAAGTTTGGAATTCCCCCTGTGAAACTTTTAAACCCAAATCAATAAAGGGCTTTCCCCAAAGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCCCCCTCCGTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839538
dbEST ID: 79657240
Trimmed Sequence: TTCATCGGATCCTGCCGGTCTTTTGGGGCCTCGCTTGCGGGGAGATCTTCTTGGGGAAGCCTTATTGATCTGGCTTAAAGTCTCAGGGGGAATCCAACTCATATCCACATCATTTTGGTTAGAAGTGCCCATCTCCACTTTCTGAGCTGGTCTTTTTCTCTTTCTGGATTCCAGCAGCTGATGCAGACCAACAATCACAAGCAATCCAAGCCCACCAAGGAACATGTACATGAATATCGTTTCTCCATCCAGACCATCCTCCTTCTCAATGATAGTAACTGTCTGATTGAAGACAGCATCTTGGAAAGCATTTCCATTTGCGTCTTTATAGTTCAAATTGATGACAAGTCCAAAAGGACGTCCTCCCATGGGCTCAGCAGGAATGAAGGAATACTCAAATGTGGCCTGTTTTTGTGGGGGGACAACCGTGTTTAAAGGCAGAGCTGTAAAATTCTGAATGTAGAACTGGTAGTCCTGAGGGTATCTGAATGAGGCATCCAGTGATTCAACGATGAAGTTTTCAGGCCCCTGGTTGGTAAAGCCCACCAAGAACTTAGCAATATCATTTGCTGGGAAATCTCACCTTTTTACATAAAGAAGAGGGTATCCGCCTTGGGGGGAAGCTTGGGGCTCTTCCGGAGCTAAGTCATCCTCCTCCCCCTTTTTTCTCCGTTCGGGGTCGGTGGTAGGCGTCCTCCGTAAACTTTAGGCTTCATCAATTCATTCTCTCTTGGACAAACCAAAATCAATCAATTGTGGCGATCCTTTAAT
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCATCGGATCCTGCCGGTCTTTTGGGGCCTCGCTTGCGGGGAGATCTTCTTGGGGAAGCCTTATTGATCTGGCTTAAAGTCTCAGGGGGAATCCAACTCATATCCACATCATTTTGGTTAGAAGTGCCCATCTCCACTTTCTGAGCTGGTCTTTTTCTCTTTCTGGATTCCAGCAGCTGATGCAGACCAACAATCACAAGCAATCCAAGCCCACCAAGGAACATGTACATGAATATCGTTTCTCCATCCAGACCATCCTCCTTCTCAATGATAGTAACTGTCTGATTGAAGACAGCATCTTGGAAAGCATTTCCATTTGCGTCTTTATAGTTCAAATTGATGACAAGTCCAAAAGGACGTCCTCCCATGGGCTCAGCAGGAATGAAGGAATACTCAAATGTGGCCTGTTTTTGTGGGGGGACAACCGTGTTTAAAGGCAGAGCTGTAAAATTCTGAATGTAGAACTGGTAGTCCTGAGGGTATCTGAATGAGGCATCCAGTGATTCAACGATGAAGTTTTCAGGCCCCTGGTTGGTAAAGCCCACCAAGAACTTAGCAATATCATTTGCTGGGAAATCTCACCTTTTTACATAAAGAAGAGGGTATCCGCCTTGGGGGGAAGCTTGGGGCTCTTCCGGAGCTAAGTCATCCTCCTCCCCCTTTTTTCTCCGTTCGGGGTCGGTGGTAGGCGTCCTCCGTAAACTTTAGGCTTCATCAATTCATTCTCTCTTGGACAAACCAAAATCAATCAATTGTGGCGATCCTTTAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCATCGGATCCTGCCGGT