ORFeome > ssr3 ORF1 – XORFeome v1.0

ssr3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ssr3
Gene ID: 6255821
Gene Page ID: 964602
ORF Xenbase ID: 17298867

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053768
Original XGC clone length: 558

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ839138
dbEST ID: 79656840
Trimmed Sequence: ATGGCTCCGAAAGCTGGCAACAAGCAGCAGTCCGAGGAAGATCTGCTTATGCAAGACTTCAGCCGCAACCTGTCGGCTAAATCTTCAGCACTTTTCTATGGCAATGCTTTCATCGTGTCTGCAATCCCCATTTGGCTGTATTGGAGAATATGGCACATGGATCTTGTCCAGTCGGCTGTGTTGTACATTGTAATGACATTGCTCAGCACCTACCTTGTGGCTTTTGCATACAAGAATGTTAAATTTGTCCTCAAACACAAGGTGGCACAGAAACGTGAAGATGCTGTTTCTAGAGAAGTGACCCGAAAACTTTCGGAAGCAGACAACAGGAAGATGTCGCGAAAAGAGAAAGATGAGAGGATCCTTTGGAAGAAGAATGAAGTTGCTGATTATGAGGCAACAACATTCTCCATTTTCTACAATAATACCTTATTCCTGGTTTTGGTGATCATTGCTTCTTTCTTTATTCTGAAGAGCTTCAACCCTACCGTAAATTACATTTTATCTTTAAGTGCTTCCTCTGGACTCATTGCTCTGCTTTCTACAGGATCAAAGTT
Full Trace Sequence: TCGTGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCCGAAAGCTGGCAACAAGCAGCAGTCCGAGGAAGATCTGCTTATGCAAGACTTCAGCCGCAACCTGTCGGCTAAATCTTCAGCACTTTTCTATGGCAATGCTTTCATCGTGTCTGCAATCCCCATTTGGCTGTATTGGAGAATATGGCACATGGATCTTGTCCAGTCGGCTGTGTTGTACATTGTAATGACATTGCTCAGCACCTACCTTGTGGCTTTTGCATACAAGAATGTTAAATTTGTCCTCAAACACAAGGTGGCACAGAAACGTGAAGATGCTGTTTCTAGAGAAGTGACCCGAAAACTTTCGGAAGCAGACAACAGGAAGATGTCGCGAAAAGAGAAAGATGAGAGGATCCTTTGGAAGAAGAATGAAGTTGCTGATTATGAGGCAACAACATTCTCCATTTTCTACAATAATACCTTATTCCTGGTTTTGGTGATCATTGCTTCTTTCTTTATTCTGAAGAGCTTCAACCCTACCGTAAATTACATTTTATCTTTAAGTGCTTCCTCTGGACTCATTGCTCTGCTTTCTACAGGATCAAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAGTTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCCGCTGATATCCCCTATAATGAGTCGTATAAAGGGGTCAAAGCGGTTTCCCGGGAAAAAACAGACACAAGACAAGAAAACACAAAAAAGATAAAAAAAAAAAAAAAAAAAAAAAAAAAAGNGAGNNNAANNAACGCGCGGGGCGGGGGGGGGGGGGGGTGGNGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCCGAAAGCTGGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839137
dbEST ID: 79656839
Trimmed Sequence: CTTTGATCCTGTAGAAAGCAGAGCAATGAGTCCAGAGGAAGCACTTAAAGATAAAATGTAATTTACGGTAGGGTTGAAGCTCTTCAGAATAAAGAAAGAAGCAATGATCACCAAAACCAGGAATAAGGTATTATTGTAGAAAATGGAGAATGTTGTTGCCTCATAATCAGCAACTTCATTCTTCTTCCAAAGGATCCTCTCATCTTTCTCTTTTCGCGACATCTTCCTGTTGTCTGCTTCCGAAAGTTTTCGGGTCACTTCTCTAGAAACAGCATCTTCACGTTTCTGTGCCACCTTGTGTTTGAGGACAAATTTAACATTCTTGTATGCAAAAGCCACAAGGTAGGTGCTGAGCAATGTCATTACAATGTACAACACAGCCGACTGGACAAGATCCATGTGCCATATTCTCCAATACAGCCAAATGGGGATTGCAGACACGATGAAAGCATTGCCATAGAAAAGTGCTGAAGATTTAGCCGACAGGTTGCGGCTGAAGTCTTGCATAAGCAGATCTTCCCCGGACTGCTGCTTGTTGCCAGCTATCGGAGCCATGGTGCCC
Full Trace Sequence: CGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTGATCCTGTAGAAAGCAGAGCAATGAGTCCAGAGGAAGCACTTAAAGATAAAATGTAATTTACGGTAGGGTTGAAGCTCTTCAGAATAAAGAAAGAAGCAATGATCACCAAAACCAGGAATAAGGTATTATTGTAGAAAATGGAGAATGTTGTTGCCTCATAATCAGCAACTTCATTCTTCTTCCAAAGGATCCTCTCATCTTTCTCTTTTCGCGACATCTTCCTGTTGTCTGCTTCCGAAAGTTTTCGGGTCACTTCTCTAGAAACAGCATCTTCACGTTTCTGTGCCACCTTGTGTTTGAGGACAAATTTAACATTCTTGTATGCAAAAGCCACAAGGTAGGTGCTGAGCAATGTCATTACAATGTACAACACAGCCGACTGGACAAGATCCATGTGCCATATTCTCCAATACAGCCAAATGGGGATTGCAGACACGATGAAAGCATTGCCATAGAAAAGTGCTGAAGATTTAGCCGACAGGTTGCGGCTGAAGTCTTGCATAAGCAGATCTTCCCCGGACTGCTGCTTGTTGCCAGCTATCGGAGCCATGGTGCCCAACTTTTTGGACAAGGTTGGCATTATAAAAAGCATTGCTCATCAATTTGGTGGCACGAACAAGGTCACTATCAGTCAAAATTAAATCATTAATTGGGGGGCGAACCTTAAAACGGAACAGTGGATTACAGCAACATGGGACATGGGCAGATTAACCGGGGCACCCCCTGGCCCCGTTNTTCCAAAAATTTCCTTGTAAATTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTGATCCTGTAGAAAGCAGA