ORFeome > ssr4 ORF1 – XORFeome v1.0

ssr4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ssr4
Gene ID: 968235
Gene Page ID: 968230
ORF Xenbase ID: 17298879

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078540
Original XGC clone length: 447

Human orthology & disease relationships

NCBI Entrez ID: 6748
Ensembl gene IDs: ENSG00000180879
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 105400,125853,148700,151623,162210,193520,275355,303600,607785

Library Location

Plate ID: GDExl11005
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ839775
dbEST ID: 79657477
Trimmed Sequence: ATGGCAGGGGTTTGTGATGTGTTTCTGGCGGTGTTGGTGGTTTTAGCGGGCTGTTCTGCTGAGCCTTGCACAGAGCCTGTTATAGTTCCTTCCTATTACACTACTCCAGATGCAGTTATATCTTCAGAAGTGGTTTTCATCGTGGAGATATCCCTTTCTTGCACTAATGGTGCACAGAATGTTGCTCTTTATGCTGATGTGAATGGGAAACAGTTCCCTGTGACCAGAGGACAGGATGTTGGGCGTTACCAAGTCTCATGGAGCCTGGAACACAAAAATGCTCATTCTGGAACATATGAGGTTAAGTTTTTCGATGAGGAGTCTTACAGTCTGCTAAGAAAGGGTGCATGGAATGGTCCTTGGGTATCCACAGACGTGCTGGCAGCATTGATAGGCATATTGGTATATTATACGGCATATACTGCAAAGAGCAACATCCAGGCTTT
Full Trace Sequence: TTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGGGGTTTGTGATGTGTTTCTGGCGGTGTTGGTGGTTTTAGCGGGCTGTTCTGCTGAGCCTTGCACAGAGCCTGTTATAGTTCCTTCCTATTACACTACTCCAGATGCAGTTATATCTTCAGAAGTGGTTTTCATCGTGGAGATATCCCTTTCTTGCACTAATGGTGCACAGAATGTTGCTCTTTATGCTGATGTGAATGGGAAACAGTTCCCTGTGACCAGAGGACAGGATGTTGGGCGTTACCAAGTCTCATGGAGCCTGGAACACAAAAATGCTCATTCTGGAACATATGAGGTTAAGTTTTTCGATGAGGAGTCTTACAGTCTGCTAAGAAAGGGTGCATGGAATGGTCCTTGGGTATCCACAGACGTGCTGGCAGCATTGATAGGCATATTGGTATATTATACGGCATATACTGCAAAGAGCAACATCCAGGCTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCCACTGAAATCCCCTATACTGAGTCGTATTACATGGTTCATAACTAAAAAAAAAAAAAAAAAAAAAAAATCTCAAATCCCTCCATCTAAAACAAAAAAAAAAAATCTCCCCTTTCCCTCCCCCCTTCTTTCGTTGTTGTCTGGTGGGGGCCCGGTAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAATATAATATTTAAAATAATAGAATGGGGCCCCCCCCCCGCCGCCCCCCCCACCCCCCACAACCAACGCAATTCGCGCGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGGGGTTTGTGATGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839774
dbEST ID: 79657476
Trimmed Sequence: AGCCTGGATGTTGCTCTTTGCAGTATATGCCGTATAATATACCAATATGCCTATCAATGCTGCCAGCACGTCTGTGGATACCCAAGGACCATTCCATGCACCCTTTCTTAGCAGACTGTAAGACTCCTCATCGAAAAACTTAACCTCATATGTTCCAGAATGAGCATTTTTGTGTTCCAGGCTCCATGAGACTTGGTAACGCCCAACATCCTGTCCTCTGGTCACAGGGAACTGTTTCCCATTCACATCAGCATAAAGAGCAACATTCTGTGCACCATTAGTGCAAGAAAGGGATATCTCCACGATGAAAACCACTTCTGAAGATATAACTGCATCTGGAGTAGTGTAATAGGAAGGAACTATAACAGGCTCTGTGCAAGGCTCAGCAGAACAGCCCGCTAAAACCACCAACACCGCCAGAAACACATCACAAACCCCTGCCATGG
Full Trace Sequence: GGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCCTGGATGTTGCTCTTTGCAGTATATGCCGTATAATATACCAATATGCCTATCAATGCTGCCAGCACGTCTGTGGATACCCAAGGACCATTCCATGCACCCTTTCTTAGCAGACTGTAAGACTCCTCATCGAAAAACTTAACCTCATATGTTCCAGAATGAGCATTTTTGTGTTCCAGGCTCCATGAGACTTGGTAACGCCCAACATCCTGTCCTCTGGTCACAGGGAACTGTTTCCCATTCACATCAGCATAAAGAGCAACATTCTGTGCACCATTAGTGCAAGAAAGGGATATCTCCACGATGAAAACCACTTCTGAAGATATAACTGCATCTGGAGTAGTGTAATAGGAAGGAACTATAACAGGCTCTGTGCAAGGCTCAGCAGAACAGCCCGCTAAAACCACCAACACCGCCAGAAACACATCACAAACCCCTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCGAGCTTAAGACTGACCGTCGTTTTCACCCACGTGACTGGGGAGATACCGGAAGCTCTGGCCGGTGTCTCAAATCNNNTGATGTTACAANNNNNNNNNNNNNNNNNNNNNNNGAAAAAAAGACAAACAAACCAAACACTCNNNNNNTTTANAAAAAAANANNAAGNNTNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCCTGGATGTTGCTCTT