ORFeome > st3gal2.2 ORF1 – XORFeome v1.0

st3gal2.2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: st3gal2.2
Gene ID: 5928563
Gene Page ID: 5928489
ORF Xenbase ID: 17298921

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC153764
Original XGC clone length: 999

Human orthology & disease relationships

NCBI Entrez ID: 6483
Ensembl gene IDs: ENSG00000157350
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ839026
dbEST ID: 79656728
Trimmed Sequence: ATGTATTGTGTCCGTTTATGTTGCCGAGTTCTCCACCACCAAAAGATCACTTGGGTTCCACCTGTGTTGTGTTTAGTGGTCTTCCTGATTTATCTCTCCTTCTCCATGGAATATTCCAGCCCTGTTGAGAGGGTGGAGACAATTAACAGCCAGGGTTGCATGTGTGGCCACTGTAGGCAAGAGAAGCGGAAGAGGACTGAATTTTTTGAAAGTCGTTTTAATGGCACAGTAGAGCCCTTACTTCTGGGAAAGTATCAATACATGCCTGATCATGTAAAGAAATGGTGGCTGAGGCTCCAAGGGAGGAACAATGCCAGTGACATACAGAAGGTGCTCGAGCAGACATTCAAGGTAGTTCCTACAGAAAACCTGTACCTTGAACAGGACAACCGGCCTTGCAGGCGATGTGCCGTTGTTGGGAATTCTGGCAACCTGAAAGGATCCCGATACGGGAAAAAGATAGATTCCCACAGATTCATTTTCAGAATGAATGGAGCGCGTACCTACGGCTTTGAAAATGACGTGGGTTCCAGGACAACCCATCACTTTATGTATCCAGAGAGCGCTGTCCACCTCCAGCCTGGTGTCCACTTGGTGTTGATCCCGTTCAACCTCCAAGACCTCAAATGGATTACCAGTGCGCTAACAACTGGAGAGGTCACCTACACTTTACAACGAATTGAAAAAATTTTATCCAGGCTGATAAAGGATAAGGTCCTGGAAATTTAACCCCTCCTTTTTTTAAATTTGTTCCTTTACAACCTGGACGAAACCCACCAGGGGGAAAATATTCCCCCCTAAGGGGAAATGTTTTGCCCCCCGGGTTCTTTGTCCGTTTTC
Full Trace Sequence: CGAGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTATTGTGTCCGTTTATGTTGCCGAGTTCTCCACCACCAAAAGATCACTTGGGTTCCACCTGTGTTGTGTTTAGTGGTCTTCCTGATTTATCTCTCCTTCTCCATGGAATATTCCAGCCCTGTTGAGAGGGTGGAGACAATTAACAGCCAGGGTTGCATGTGTGGCCACTGTAGGCAAGAGAAGCGGAAGAGGACTGAATTTTTTGAAAGTCGTTTTAATGGCACAGTAGAGCCCTTACTTCTGGGAAAGTATCAATACATGCCTGATCATGTAAAGAAATGGTGGCTGAGGCTCCAAGGGAGGAACAATGCCAGTGACATACAGAAGGTGCTCGAGCAGACATTCAAGGTAGTTCCTACAGAAAACCTGTACCTTGAACAGGACAACCGGCCTTGCAGGCGATGTGCCGTTGTTGGGAATTCTGGCAACCTGAAAGGATCCCGATACGGGAAAAAGATAGATTCCCACAGATTCATTTTCAGAATGAATGGAGCGCGTACCTACGGCTTTGAAAATGACGTGGGTTCCAGGACAACCCATCACTTTATGTATCCAGAGAGCGCTGTCCACCTCCAGCCTGGTGTCCACTTGGTGTTGATCCCGTTCAACCTCCAAGACCTCAAATGGATTACCAGTGCGCTAACAACTGGAGAGGTCACCTACACTTTACAACGAATTGAAAAAATTTTATCCAGGCTGATAAAGGATAAGGTCCTGGAAATTTAACCCCTCCTTTTTTTAAATTTGTTCCTTTACAACCTGGACGAAACCCACCAGGGGGAAAATATTCCCCCCTAAGGGGAAATGTTTTGCCCCCCGGGTTCTTTGTCCGTTTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATTGTGTCCGTTTATGTTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839025
dbEST ID: 79656727
Trimmed Sequence: TTTGTAAAGTTTTAGCCTTCCTTCTTCCACTAATTCTGTTATGAGCTCAGACTCAAACTCTGCATTGTGTACTCCTGTCCAGCGAAATGCTCCTGCAAATCTGTTCCTTTCCCAGTAGTGGTGCCAGTTGCCGTGTTGATCAGCGCCAAAGCCAAACACAGATATCTCATCACAGATATGTAACGCAAAGACCAGGGCCAACATTCCAGTAGATGGATATTTCCCATGATGGTTAGTCCAGTTGTCATGGACATATTTAAAAAAAGAGGGGTTAAATATCAAGACCTTATCTTTATCAGCCTGGATAAATTTCTTCACTCGCTTGTAAGTGTAGGTGACCTCTCCAGTTGTTAGCGCACTGGTAATCCATTTGAGGTCTTGGAGCTTGAACGGGATCAACACCAAGTGGACACCAGGCTGGAGGTGGACAGCGCTCTCTGGATACATAAAGTGATGGGTTGTCCTGGAACCCACGTCATTTTCAAAGCCCTAGGTACGCGCTCCATTCATTCTGAAAATGAATCTGTGGGAATCTATCTTTTTCCCGTATCGGGGATCCTTTCAAGTTGCCAGAATTCCCCACAACGGCCCATCGCCCTGCAAGGCCGGGTGGTCCTGTCAAGGTACCGGGTTTTCTGGAAGAACTTAACTTTAAATGTCCTGCCTCAAGCCACCTTCTGTTATTTTCCTGGGGCATTTTTTCCCTCCCTTTGAGAGCCCTCAGCCGACCAATTTCCTTTTACAATAAAATAAGGGCCAAATTTA
Full Trace Sequence: GGGAATCGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGTAAAGTTTTAGCCTTCCTTCTTCCACTAATTCTGTTATGAGCTCAGACTCAAACTCTGCATTGTGTACTCCTGTCCAGCGAAATGCTCCTGCAAATCTGTTCCTTTCCCAGTAGTGGTGCCAGTTGCCGTGTTGATCAGCGCCAAAGCCAAACACAGATATCTCATCACAGATATGTAACGCAAAGACCAGGGCCAACATTCCAGTAGATGGATATTTCCCATGATGGTTAGTCCAGTTGTCATGGACATATTTAAAAAAAGAGGGGTTAAATATCAAGACCTTATCTTTATCAGCCTGGATAAATTTCTTCACTCGCTTGTAAGTGTAGGTGACCTCTCCAGTTGTTAGCGCACTGGTAATCCATTTGAGGTCTTGGAGCTTGAACGGGATCAACACCAAGTGGACACCAGGCTGGAGGTGGACAGCGCTCTCTGGATACATAAAGTGATGGGTTGTCCTGGAACCCACGTCATTTTCAAAGCCCTAGGTACGCGCTCCATTCATTCTGAAAATGAATCTGTGGGAATCTATCTTTTTCCCGTATCGGGGATCCTTTCAAGTTGCCAGAATTCCCCACAACGGCCCATCGCCCTGCAAGGCCGGGTGGTCCTGTCAAGGTACCGGGTTTTCTGGAAGAACTTAACTTTAAATGTCCTGCCTCAAGCCACCTTCTGTTATTTTCCTGGGGCATTTTTTCCCTCCCTTTGAGAGCCCTCAGCCGACCAATTTCCTTTTACAATAAAATAAGGGCCAAATTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGTAAAGTTTTAGCCTTCCTTC