ORFeome > stard4 ORF1 – XORFeome v1.0

stard4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: stard4
Gene ID: 5944118
Gene Page ID: 5944116
ORF Xenbase ID: 17298987

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129726
Original XGC clone length: 621

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ838670
dbEST ID: 79656372
Trimmed Sequence: ATGGATGACCTTGATATCCCTTCAAAAACAACCAAATTGCAAAATACCTTAATTCAGTACCACTGCACGCTCGAAGAGGAATGGCGTGTCGCCAAGAAATCAAGTGATGTTACGGCATGGCGAAAACCTTCTGAAGAATTTGGCGGTTGCCTGTACAAAATTGAAGGAATAGTGGAAGATGATTATAACAGAATTGTGGATTACATTCGCCCTGGACCCTATAGACTGCAGTGGGACAGCTTAATGACCTCAATGGACATAATAAAGGAATTCAATAAGGAGTGCTGTGTGATGCGCTACACAACTGCTGGACAGCTGCTGAATATTATATCGCCGAGAGAGTTTGTTGACTTCTCCTACACAACGCAGTATGAAGATGGCCTTCTGACTTGTGGTGTCGGCATTGAATATGAAGATGCTCGACCAAACTGTGTGCGCGGGTTCAATCACCCATGCGGCTGGTTCTGTGTGCCCCTGCAAAACAACCCTCAACACAGCCTTCTGACTGGCTACATTCAGACTGATCTGAGAGGGATGCTGCTGCAGAAGACTGTAGACTTCGCAATGGCAAGCTCACTGGTAAACTTCTATTCCGACCTCAAAAAGGCACTGAAGCCCTTT
Full Trace Sequence: CTCGAGGGCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGACCTTGATATCCCTTCAAAAACAACCAAATTGCAAAATACCTTAATTCAGTACCACTGCACGCTCGAAGAGGAATGGCGTGTCGCCAAGAAATCAAGTGATGTTACGGCATGGCGAAAACCTTCTGAAGAATTTGGCGGTTGCCTGTACAAAATTGAAGGAATAGTGGAAGATGATTATAACAGAATTGTGGATTACATTCGCCCTGGACCCTATAGACTGCAGTGGGACAGCTTAATGACCTCAATGGACATAATAAAGGAATTCAATAAGGAGTGCTGTGTGATGCGCTACACAACTGCTGGACAGCTGCTGAATATTATATCGCCGAGAGAGTTTGTTGACTTCTCCTACACAACGCAGTATGAAGATGGCCTTCTGACTTGTGGTGTCGGCATTGAATATGAAGATGCTCGACCAAACTGTGTGCGCGGGTTCAATCACCCATGCGGCTGGTTCTGTGTGCCCCTGCAAAACAACCCTCAACACAGCCTTCTGACTGGCTACATTCAGACTGATCTGAGAGGGATGCTGCTGCAGAAGACTGTAGACTTCGCAATGGCAAGCTCACTGGTAAACTTCTATTCCGACCTCAAAAAGGCACTGAAGCCCTTTGCCACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTAACAATTTGTTGCAACGAACAGGGTCACTATCAGTCCAAATAAAAAACATTATTTGCCCATCAAACTTAAAACCCCCAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGACCTTGATATCCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838669
dbEST ID: 79656371
Trimmed Sequence: AGGCTTCAGTGCCTTTTTGAGGTCGGAATAGAAGTTTACCAGTGAGCTTGCCATTGCGAAGTCTACAGTCTTCTGCAGCAGCATCCCTCTCAGATCAGTCTGAATGTAGCCAGTCAGAAGGCTGTGTTGAGGGTTGTTTTGCAGGGGCACACAGAACCAGCCGCATGGGTGATTGAACCCGCGCACACAGTTTGGTCGAGCATCTTCATATTCAATGCCGACACCACAAGTCAGAAGGCCATCTTCATACTGCGTTGTGTAGGAGAAGTCAACAAACTCTCTCGGCGATATAATATTCAGCAGCTGTCCAGCAGTTGTGTAGCGCATCACACAGCACTCCTTATTGAATTCCTTTATTATGTCCATTGAGGTCATTAAGCTGTCCCACTGCAGTCTATAGGGTCCAGGGCGAATGTAATCCACAATTCTGTTATAATCATCTTCCACTATTCCTTCAATTTTGTACAGGCAACCGCCAAATTCTTCAAAAGGTTTTCGCCATGCCGTAGCATCACTTGATTTCTTGGCGACACGCCGTTCCTCTTCTAGCGTGCCGTGGTACTGAATTAAGGTATTTTGGAATTTGGTGGTTTTTGAGGGGATATCAAGGGCATCCATGGGGC
Full Trace Sequence: GGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGCTTCAGTGCCTTTTTGAGGTCGGAATAGAAGTTTACCAGTGAGCTTGCCATTGCGAAGTCTACAGTCTTCTGCAGCAGCATCCCTCTCAGATCAGTCTGAATGTAGCCAGTCAGAAGGCTGTGTTGAGGGTTGTTTTGCAGGGGCACACAGAACCAGCCGCATGGGTGATTGAACCCGCGCACACAGTTTGGTCGAGCATCTTCATATTCAATGCCGACACCACAAGTCAGAAGGCCATCTTCATACTGCGTTGTGTAGGAGAAGTCAACAAACTCTCTCGGCGATATAATATTCAGCAGCTGTCCAGCAGTTGTGTAGCGCATCACACAGCACTCCTTATTGAATTCCTTTATTATGTCCATTGAGGTCATTAAGCTGTCCCACTGCAGTCTATAGGGTCCAGGGCGAATGTAATCCACAATTCTGTTATAATCATCTTCCACTATTCCTTCAATTTTGTACAGGCAACCGCCAAATTCTTCAAAAGGTTTTCGCCATGCCGTAGCATCACTTGATTTCTTGGCGACACGCCGTTCCTCTTCTAGCGTGCCGTGGTACTGAATTAAGGTATTTTGGAATTTGGTGGTTTTTGAGGGGATATCAAGGGCATCCATGGGGCCCACTTTTTTGTACAAAGTTGGGATTAAAAAAAAGAATGGCTCATCAATTTGTTGGCAACCAACAAGGTTCCCTAATAAAAAAAAAAAAAAAAAAACAAATAAAAAAAGGAAACCAAGGCTTAAGAACGGGGCCGTCCGTTTCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGCTTCAGTGCCTTTTTGAGGT