ORFeome > stard7 ORF1 – XORFeome v1.0

stard7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: stard7
Gene ID: 981986
Gene Page ID: 981982
ORF Xenbase ID: 17298999

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC133199
Original XGC clone length: 993

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ838539
dbEST ID: 79656241
Trimmed Sequence: ATGTGGCAGCGGGCTTTTCGAGGGGCTTCAGCCGGTGTCCTGGGTTGGTTGCGCTACCGCCTGCCGCACCTGTGCTGGAATGGATGCACAAAGCAGCGCAACACTCGGGCCCTCGTCCGCGGGCTACGGTACAGTAACAGGCCTGGGAAGACGGGCAGACTCCTGGCAGCGCTCACCGGGGCCTTCTTATGGGATGAGGAGCGAGTTCGAGAAGAGGAGATCATAAGGCCAGCCGAGGACATGAAGCGCATGAGGCCGGGGGCTGATACGATCCGGGGACAGACTTCTACCGACACTGAAGACCAGGGATGGGAACTGGTTGTGGACAAAAAGGATTTCAAACTGTGGAGGCGCCCAATTGAAGGGACACACCTGTACCAGTACAGAGTGTTTGGGTCATACAGAGACGTCACCCCTCGTCAGTTCTTTAACGTTCAGCTGGATACAGAATACCGTAAGAAATGGGATGCACTGGTTATTAAACTGGATGTCATTGAGCGAGATGGAGAGTCTGGATCAGAAATCATTCACTGGGTTACTCACTTTCCTTACCCCATGTATTCACGGGATTACGTCTATGTAAGGAAATATCACGTCCATCAGGAAAAAAACCTTATGGTATTAGTGTCTCGAGCGGTGCAACATCCCTCCATTCCGGAAATCTCCAAATTATTTCCGAAGTCCCAATTTACCCGTCCCAAAAAGGTTATTCCGCCCTTACAAGTCTTTTAAAATAAAAAAGGTTTTTGAATTAACTTGCTGAACCTTACACCCAAAAACCCCCTCAAAAATGGTATATTCCCCACC
Full Trace Sequence: TCGGGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGCAGCGGGCTTTTCGAGGGGCTTCAGCCGGTGTCCTGGGTTGGTTGCGCTACCGCCTGCCGCACCTGTGCTGGAATGGATGCACAAAGCAGCGCAACACTCGGGCCCTCGTCCGCGGGCTACGGTACAGTAACAGGCCTGGGAAGACGGGCAGACTCCTGGCAGCGCTCACCGGGGCCTTCTTATGGGATGAGGAGCGAGTTCGAGAAGAGGAGATCATAAGGCCAGCCGAGGACATGAAGCGCATGAGGCCGGGGGCTGATACGATCCGGGGACAGACTTCTACCGACACTGAAGACCAGGGATGGGAACTGGTTGTGGACAAAAAGGATTTCAAACTGTGGAGGCGCCCAATTGAAGGGACACACCTGTACCAGTACAGAGTGTTTGGGTCATACAGAGACGTCACCCCTCGTCAGTTCTTTAACGTTCAGCTGGATACAGAATACCGTAAGAAATGGGATGCACTGGTTATTAAACTGGATGTCATTGAGCGAGATGGAGAGTCTGGATCAGAAATCATTCACTGGGTTACTCACTTTCCTTACCCCATGTATTCACGGGATTACGTCTATGTAAGGAAATATCACGTCCATCAGGAAAAAAACCTTATGGTATTAGTGTCTCGAGCGGTGCAACATCCCTCCATTCCGGAAATCTCCAAATTATTTCCGAAGTCCCAATTTACCCGTCCCAAAAAGGTTATTCCGCCCTTACAAGTCTTTTAAAATAAAAAAGGTTTTTGAATTAACTTGCTGAACCTTACACCCAAAAACCCCCTCAAAAATGGTATATTCCCCACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGCAGCGGGCTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838538
dbEST ID: 79656240
Trimmed Sequence: GGCATATTCCATGTGTGGTGCAGGATGGGCAGCGGCGTTCTTCCTTTCCGGGCTGGCTCTGCTCTCGCTGCCACAATCCTGGGGGCGGAAGGAGATGTAATCTCTCACTTTAATCTCCTGGTTCTTAGCCTGCACAGTTGCCATATGTAATTTGTCCAGGAAATCCGGCATTCCACTGGACACCATCCAGTTGACACAGTAGCGTGGGAATACAGTCTGAGGGTTGTCGCTGTAAGTCAGCAAGTAATCAAAACCATTCTCATCAAAAGACGTGTGAGGCTGGATAACCATCTGGGACTGGTAATTGCGCACTCGGACATAATCTGGAGATTCCGGAATGGAGGGATGTTGCACCGCTCGAGACACTAATACCATAAGGTTGTTTTCCTGATCGACGTGATATTTCCTTACATAGACGTAATCCCGTGAATACATGGGGTAAGGAAAGTGAGTAACCCAGTGAATGATTTCTGATCCAGACTCTCCCTCTCGCTCAATGACATCCGGTTTAATAACCAGTGCATCCCATTTCTTACGGTATTCGGTATCCAGCTGAACGTTAAAAAACTGACGAAGGGTGACGTCCCTGTATGACCCCAACACTCCTTACTGGTACAGGTGTGTCCCTTCAATTGGCCGCCTCCCCGGTTTAAAATCCTTTTTGTTCCCCAACCCTTTCCCAACCCTTGGCCTTCCAATGTCCTGTGAAAATCTTGTCCCCCGAAACCGTAACAACCCCCCGCCCCCCTTGCCCCCTCTCATTTTCCCT
Full Trace Sequence: GGGAATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCATATTCCATGTGTGGTGCAGGATGGGCAGCGGCGTTCTTCCTTTCCGGGCTGGCTCTGCTCTCGCTGCCACAATCCTGGGGGCGGAAGGAGATGTAATCTCTCACTTTAATCTCCTGGTTCTTAGCCTGCACAGTTGCCATATGTAATTTGTCCAGGAAATCCGGCATTCCACTGGACACCATCCAGTTGACACAGTAGCGTGGGAATACAGTCTGAGGGTTGTCGCTGTAAGTCAGCAAGTAATCAAAACCATTCTCATCAAAAGACGTGTGAGGCTGGATAACCATCTGGGACTGGTAATTGCGCACTCGGACATAATCTGGAGATTCCGGAATGGAGGGATGTTGCACCGCTCGAGACACTAATACCATAAGGTTGTTTTCCTGATCGACGTGATATTTCCTTACATAGACGTAATCCCGTGAATACATGGGGTAAGGAAAGTGAGTAACCCAGTGAATGATTTCTGATCCAGACTCTCCCTCTCGCTCAATGACATCCGGTTTAATAACCAGTGCATCCCATTTCTTACGGTATTCGGTATCCAGCTGAACGTTAAAAAACTGACGAAGGGTGACGTCCCTGTATGACCCCAACACTCCTTACTGGTACAGGTGTGTCCCTTCAATTGGCCGCCTCCCCGGTTTAAAATCCTTTTTGTTCCCCAACCCTTTCCCAACCCTTGGCCTTCCAATGTCCTGTGAAAATCTTGTCCCCCGAAACCGTAACAACCCCCCGCCCCCCTTGCCCCCTCTCATTTTCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCATATTCCATGTGTGGT