ORFeome > stau1 ORF2 – XORFeome v1.0

stau1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: stau1
Gene ID: 920445
Gene Page ID: 920407
ORF Xenbase ID: 17299023

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC110921
Original XGC clone length: 2127

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ837684
dbEST ID: 79655386
Trimmed Sequence: ATGTCTCAAGCTCCCAAATCACCTGCCGCCACCGTCCCCAACATCCAAATCCTGAAAAATAACCAACATTCTCCTCTCCCCCAGCCTCTAAGTATCCCTTCTACTGCCAGTCCACTGCCCTCTGAAAATGCACGTACACCTCTCCAGAACTCTGCTTTACCCTCTCCATCTGTCACATCCCGCGGTCCAACTGCAGTTTCTTCTAACATGGCAAACCCCAAAGAGAAAACCCCCATGTGTCTTGTGAATGAGTTATCCCGTTTCAACAAAATTCAGCCCGTGTACAAACTGCTGATTGAACAAGGTCCGGCTCATTCTAAGGTCATTCCGCTAGGACGGTGGCAGGATTACAGCCTTCTTGAGAGAGTGGGAGAAGAACGCCCAAGACAAATGTTCACAGTGCAACTCACTCTAGGGGACCAGTACTGGGAGGCTGAAGGGACGAGTATTATAAAAGCTCATCACGCAGCTGCCGCCAAAGCCCTGGAAGGGACAAAGTACCCGAAGCCTACAGTCCGCCCTGTACGCGACAGCATCACGCCGACGGTTGAACTAAACGCTCTGTGCATGAAACTCGGAAGGAAACCCATATACAAACCTTTAGATCCCTACACTGTACAGCACAGTCTT
Full Trace Sequence: TCGAGGGCCATATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTCAAGCTCCCAAATCACCTGCCGCCACCGTCCCCAACATCCAAATCCTGAAAAATAACCAACATTCTCCTCTCCCCCAGCCTCTAAGTATCCCTTCTACTGCCAGTCCACTGCCCTCTGAAAATGCACGTACACCTCTCCAGAACTCTGCTTTACCCTCTCCATCTGTCACATCCCGCGGTCCAACTGCAGTTTCTTCTAACATGGCAAACCCCAAAGAGAAAACCCCCATGTGTCTTGTGAATGAGTTATCCCGTTTCAACAAAATTCAGCCCGTGTACAAACTGCTGATTGAACAAGGTCCGGCTCATTCTAAGGTCATTCCGCTAGGACGGTGGCAGGATTACAGCCTTCTTGAGAGAGTGGGAGAAGAACGCCCAAGACAAATGTTCACAGTGCAACTCACTCTAGGGGACCAGTACTGGGAGGCTGAAGGGACGAGTATTATAAAAGCTCATCACGCAGCTGCCGCCAAAGCCCTGGAAGGGACAAAGTACCCGAAGCCTACAGTCCGCCCTGTACGCGACAGCATCACGCCGACGGTTGAACTAAACGCTCTGTGCATGAAACTCGGAAGGAAACCCATATACAAACCTTTAGATCCCTACACTGTACAGCACAGTCTTGCCTACTTTTCTGTTACAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTATTGCAACCAAAAAAGTCACTAATAATTCCAAATAAAATTATTTATTTGCCATCCCGCCGAAAAATCCCCTAAAGGGATTCCGAATATCAATAAAACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCAAGCTCCCAAATC

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TGGCAGGTAACAGCCACTGAACAAGGACAAAGGAGTAACTAAAAGGGGAAGAAAGCCCGGAGGGCAAAAATGAAGATATATTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCTGTGCTGTCCAGTGTATGGATCTAAGGGTTTGAATATGGGTTTCCTTCCAAATTTCATGCTCACATCGTTTAGTTCAACCGTTGGCGTGATGCTGTCTCTTACAGGGCGGACTGTACGCTTCTGTTACTTTGTCCCTTCCACGGCTTTGTCGGCAGCTGCATGTTGAGCTTTTTTAATACTCATCCCTTCACCCTCCCAATACTGGTCCCCAATAGTGAGTTGCACTGTGAACATTTTTCTTGAGCGTTCTTCTCCCTCTCTCTCAACAAGGCTGTAATCCTGCCACCATCCTATCGCAATGACGTTTCAATAAGCCGGACCTTTTTCACTCACAGTTTGTAGATGGGGTGAATTTTCTTGAAAGGGGCGGGCTCTTTCTCAACACACATGGGGGTTTTCTCTGTGAGGTGTGGGCGGTGAGAAGAAAAAACTGTTATACGACTGGGAGTGACAACAAAAGGGAGGGGGGGGACAATTGAAAAAGGGGGCGTCCTTTTTTGTAAAGAGGGGAATAAAAGAGAAAAAAAAGTAACATTGTGGGGGGGGAAAAGGATGTGGTTTGTGGGGAAAGGAAAGTTGGGGGGGGGGGGAAAAAAGAAGAAAATTAAAGTGGGGGGGGGAATGTATTCCCGGAGTTTAACAGAAGAGGAGTTTGTGGGAAAAGATGGGGAAGAACAAAGAGGTGAGTGGANNTAGAAAAAAAAAAAAAGAAAAAAAAAGTATTAGGCTTCTTAAAAGGAAGGGGAAAGGAAAAAAAAAAAAAAGAGGGGGGGGGGGGGAGGACTGGTGTAAAAGAAAAAGAAAGAGAGCCGGGAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAGAGGGGGGAGAAGAGCNCNGGGANGGGGGGAAGGAAGAAGGGTGGAAAGAAGGGGGAAAAAAGAAAAGAAGGAGAGAGTGGAGAGAGGGGAGGGAGNNNTGGAAAGCGGGGGGGGNCGCAANAAGAGAAAGAAAAAAAAAAGAAAAAAAAAAAAAAAGAAAAAAAAAAAGAAAAAGGAAGGGGGGGGNGGTNGCGCGAACATCAGAGAGGGGGGANAGAGAGANACAGGGGGAGGGGAGGCAGGGNANGGGGNGGGGNANNGGGNNTGGTGGGGGANGGNGAGGNNNNNNNAAGNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCTGTGCTGTCCAGTGT