ORFeome > stim1 ORF1 – XORFeome v1.0

stim1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: stim1
Gene ID: 947977
Gene Page ID: 947968
ORF Xenbase ID: 17299059

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126011
Original XGC clone length: 2007

Human orthology & disease relationships

NCBI Entrez ID: 6786
Ensembl gene IDs: ENSG00000167323,LRG_164
Directly associated (OMIM) disease MIM numbers: 160565,185070,612783
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ837360
dbEST ID: 79655062
Trimmed Sequence: ATGCTTTGGTGTCGGACTCTGCTATGGGCTTTGTGCGCTTCCTTTCTGCAGCCGAGCCGGCCCGAGAGCCCCACGGAAAGTACCGAGGAGGATCCTATGCTGAGCGAATTCTGTCGGATAGACAAGCTCCTGTGCCACAGTACTGATGAGCTGCTCAGCTTCGAGGCGGTGATGAGTATTCACAAACAGATGGACGATGATGCCAACGGCAGTGTGGATGTTGAGGAGAGCGACGAGTTTCTCAGGGAAGACCTGAATTACCACGACCCCACAGCCAAGCACAGCACCTTCCATGGAGAGGACAAGCTGATCAGTGTGGAGGATCTTTGGAACAGCTGGAAAATATCAGAAGTCTATAACTGGACGGTGGATGAAGTGGCCCAGTGGTTGATCACATATGTGGAGCTGCCCCAGTATGAAGAGACATTCCGCAAGCTGCAGCTCAGTGGCAGAGACATGCCCAGGTTGGCAATCGCCAACGCCACCATGACGGGCACCCTCCTGAAAATGACCGACCGCAGTCAGAGGCAGAAGCTGCAGCTCAAGGCGTTGGACCACGGTGCTGTTTGGGCCTCCTCTGTTGACTCGTCACAATCATCTCAAGGACTTCATGTTGGTCGTGTCATCGCTCNGGGGTGGGGGGGGGGTGCGGGTTTGTCACCTTCGGAACCCCCTACTCCAAGGACCACTTGAGGAAGAAGATGAGGGAACTGGAAGGGTTTGCACTGGGCGGAGCAGAATTCTCCTGACCTTCCAGGAAAAGCTGCCAAAGGGCCCCCGGAGACCACCCAACGGGGGGGAAAAAGTTGGAAAAAAGGTTCC
Full Trace Sequence: GGCACCAAATAATNGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTTTGGTGTCGGACTCTGCTATGGGCTTTGTGCGCTTCCTTTCTGCAGCCGAGCCGGCCCGAGAGCCCCACGGAAAGTACCGAGGAGGATCCTATGCTGAGCGAATTCTGTCGGATAGACAAGCTCCTGTGCCACAGTACTGATGAGCTGCTCAGCTTCGAGGCGGTGATGAGTATTCACAAACAGATGGACGATGATGCCAACGGCAGTGTGGATGTTGAGGAGAGCGACGAGTTTCTCAGGGAAGACCTGAATTACCACGACCCCACAGCCAAGCACAGCACCTTCCATGGAGAGGACAAGCTGATCAGTGTGGAGGATCTTTGGAACAGCTGGAAAATATCAGAAGTCTATAACTGGACGGTGGATGAAGTGGCCCAGTGGTTGATCACATATGTGGAGCTGCCCCAGTATGAAGAGACATTCCGCAAGCTGCAGCTCAGTGGCAGAGACATGCCCAGGTTGGCAATCGCCAACGCCACCATGACGGGCACCCTCCTGAAAATGACCGACCGCAGTCAGAGGCAGAAGCTGCAGCTCAAGGCGTTGGACCACGGTGCTGTTTGGGCCTCCTCTGTTGACTCGTCACAATCATCTCAAGGACTTCATGTTGGTCGTGTCATCGCTCNGGGGTGGGGGGGGGGTGCGGGTTTGTCACCTTCGGAACCCCCTACTCCAAGGACCACTTGAGGAAGAAGATGAGGGAACTGGAAGGGTTTGCACTGGGCGGAGCAGAATTCTCCTGACCTTCCAGGAAAAGCTGCCAAAGGGCCCCCGGAGACCACCCAACGGGGGGGAAAAAGTTGGAAAAAAGGTTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTTGGTGTCGGACT

Sequences - 3ʹ (reverse) EST

Accession: JZ837359
dbEST ID: 79655061
Trimmed Sequence: CTTCTTTGGCTTCTTAAAGATTTTCAGTGTCAACTTCTTCTTGCCCGAGACCGAGTCAGTGTCCTCTCCTGTGGATCCACTGTCATCTTCAGCCACGGCCTTCTTTCCCGCCAGCTGTGGGATGCGGGTACCCTTGGAATTGTTGTGCTTCGATTCCGTCCCTGGAGAAGGTGTGTCGGCTTCTGTGGAACTTGGGCTGTGGGATCTTGAAGAGTCCGAATGGGACTGAATGGTACCGGCTGTGCTGATCTCACCCAAGCTGGGGGATTTTTCAGACAACTTATTGCTCATCTGTGGGCTTTCAGGCACACTCTCGTGCCCGGCACCTACGTTTGCCAGTTCCAGATGACGGTTTCCTCCATTGGGCGTCTGACTGCCAGATGGCACCTCTTCCAAGGTTCTGGGCAAGGCTTTGGAGCTGGGGATTTTGGAACTGTGCCCACTGACTCTTTGCTCAATCATGTAGGGGGATGGAGGATTCAGAATCTGAGCGACTCAGGTCCCTCTGGGGTCCGAGTGCAAGCTGGGAGTCCACGTGTCGCTGCCGAAGGCTCANGTTGGGGGATTGCATAGTGATGGGAGATACAATATCTTCATCCAAGTCATCGAGGTCGTCCCACATAATGAAATGTGTGGGGTGCAGGGCGAGAACACCCCCATAAGGGTGGGGGTCTATAGTTCAGAAGCCGTCATTCAACCCAATGAACCCCCGGGGGTTATGGAAAATCTGGAAAAACCAAAAAAAGGGTTCTCGAAATCTGCCTGCGCAGCCAAAGGCCAAA
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCTTTGGCTTCTTAAAGATTTTCAGTGTCAACTTCTTCTTGCCCGAGACCGAGTCAGTGTCCTCTCCTGTGGATCCACTGTCATCTTCAGCCACGGCCTTCTTTCCCGCCAGCTGTGGGATGCGGGTACCCTTGGAATTGTTGTGCTTCGATTCCGTCCCTGGAGAAGGTGTGTCGGCTTCTGTGGAACTTGGGCTGTGGGATCTTGAAGAGTCCGAATGGGACTGAATGGTACCGGCTGTGCTGATCTCACCCAAGCTGGGGGATTTTTCAGACAACTTATTGCTCATCTGTGGGCTTTCAGGCACACTCTCGTGCCCGGCACCTACGTTTGCCAGTTCCAGATGACGGTTTCCTCCATTGGGCGTCTGACTGCCAGATGGCACCTCTTCCAAGGTTCTGGGCAAGGCTTTGGAGCTGGGGATTTTGGAACTGTGCCCACTGACTCTTTGCTCAATCATGTAGGGGGATGGAGGATTCAGAATCTGAGCGACTCAGGTCCCTCTGGGGTCCGAGTGCAAGCTGGGAGTCCACGTGTCGCTGCCGAAGGCTCANGTTGGGGGATTGCATAGTGATGGGAGATACAATATCTTCATCCAAGTCATCGAGGTCGTCCCACATAATGAAATGTGTGGGGTGCAGGGCGAGAACACCCCCATAAGGGTGGGGGTCTATAGTTCAGAAGCCGTCATTCAACCCAATGAACCCCCGGGGGTTATGGAAAATCTGGAAAAACCAAAAAAAGGGTTCTCGAAATCTGCCTGCGCAGCCAAAGGCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTTTGGCTTCTTAAAGAT