ORFeome > stk17a ORF1 – XORFeome v1.0

stk17a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: stk17a
Gene ID: 5757624
Gene Page ID: 5757565
ORF Xenbase ID: 17299089

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133765
Original XGC clone length: 1254

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ838485
dbEST ID: 79656187
Trimmed Sequence: ATGATTCCGGAGGAGGGATACGGGGCGCCGGACAAGTGTTGTCGGACCCCAAGAGCTGCGAGGAGACCAAAGCGAGACGAGGAGAACTGCACGGACAGAGTGGGACTGTTGGGAGAGCCGAGTATCCCCATCCGGAGTCAAGCCTTCAGCTCCACCTACAGCATCTCCCCGGGACATGAGCTGGGCAGAGGCAAATTTGCAGTTGTAAGAAAATGCGTGGAAAAGGAAACTGGAAAAGAATTTGCAGCAAAATTTATGAGAAAACGAAGAAAGGGCCAGGACTGTCGAATGGAAATCATCCATGAAATTGCAGTTTTGGAGCTGGCTAGAGGCAGCCCTTGGGTTATCACACTGCATGAAGTCTACGAGACTGCCACTGAAATGATCCTAGTACTGGAATACGCTGCTGGCGGTGAGATATTTATCCAGTGTGTAGCAGAAAGGAAAGAAGCCGTCTTCGAGAAAGATGTCCGGAGGCTTATTAAGCAGATATTAGAAAGAGTTGCCTTTCTTCCCCGGCGCCGTATCCCCCAACTAGGGGGGGTTGCGCCCCACAAATATTCTGCCCAGGAAACTGAAATCTGCCCCGGGGAGGTAAAAATAAAGTTTAGATTGGCGGGGAAGAAAAAATTTGAGACCG
Full Trace Sequence: TCGAGGGCCCAATAATTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTCCGGAGGAGGGATACGGGGCGCCGGACAAGTGTTGTCGGACCCCAAGAGCTGCGAGGAGACCAAAGCGAGACGAGGAGAACTGCACGGACAGAGTGGGACTGTTGGGAGAGCCGAGTATCCCCATCCGGAGTCAAGCCTTCAGCTCCACCTACAGCATCTCCCCGGGACATGAGCTGGGCAGAGGCAAATTTGCAGTTGTAAGAAAATGCGTGGAAAAGGAAACTGGAAAAGAATTTGCAGCAAAATTTATGAGAAAACGAAGAAAGGGCCAGGACTGTCGAATGGAAATCATCCATGAAATTGCAGTTTTGGAGCTGGCTAGAGGCAGCCCTTGGGTTATCACACTGCATGAAGTCTACGAGACTGCCACTGAAATGATCCTAGTACTGGAATACGCTGCTGGCGGTGAGATATTTATCCAGTGTGTAGCAGAAAGGAAAGAAGCCGTCTTCGAGAAAGATGTCCGGAGGCTTATTAAGCAGATATTAGAAAGAGTTGCCTTTCTTCCCCGGCGCCGTATCCCCCAACTAGGGGGGGTTGCGCCCCACAAATATTCTGCCCAGGAAACTGAAATCTGCCCCGGGGAGGTAAAAATAAAGTTTAGATTGGCGGGGAAGAAAAAATTTGAGACCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTCCGGAGGAGGGAT

Sequences - 3ʹ (reverse) EST

Accession: JZ838484
dbEST ID: 79656186
Trimmed Sequence: GAAAATGAAGTCTCCTGCTATCTCTTGCATTATAGGCTCCTCAAACTTAAAGCGTTTGGTCGTGGCCTTAAATTCAAATTGTTTCTCTAATTCAGTCTGTCTGCACTGTCCCAGTGTATAAAATGCCATTACAATCAATTCTTCTTCTACAGTCTGTCCTTCTGCCTCTGCAATGGAAGTGACTGGCTCTGGAAAACTGGCCTGAGTTACTTCCTCCTCTCGGTTCTCCTCTTCCGGTGTGACATGGTTGCTTTCCTGCACAGAGTTCATAGCACTAGCATATGGATCAGGAAGGTCCCCTTGGGCTAGCCAAGGATGTTGGAGACAGTCAACAGCTGACGCACGAGCTTCAGGCTTGCGAATGAGAAGTGCTTTGATGAAATCTATTGCAAAATCAAAAATGTCTTCAAAGTCCTCACTATTGTAAGTGACATTCAGCTGGGAAATATTTAGGAAGGTCTGCTGCTTGTCATCGCCCAAGAAAGGGGAGGTTCCTGTTAGCATAATGTATGCCAGTACACCAATACTCCACATGTCTGTTGCAATGCTGATTGGCTCATACCTGAAAATTTCAGGAGCAACATATTCTTGGGGTCCCCATAATTTCTCTTACCCTCCTCTTTGTTATTCAAAATTC
Full Trace Sequence: CGGGGGAAAACGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAAATGAAGTCTCCTGCTATCTCTTGCATTATAGGCTCCTCAAACTTAAAGCGTTTGGTCGTGGCCTTAAATTCAAATTGTTTCTCTAATTCAGTCTGTCTGCACTGTCCCAGTGTATAAAATGCCATTACAATCAATTCTTCTTCTACAGTCTGTCCTTCTGCCTCTGCAATGGAAGTGACTGGCTCTGGAAAACTGGCCTGAGTTACTTCCTCCTCTCGGTTCTCCTCTTCCGGTGTGACATGGTTGCTTTCCTGCACAGAGTTCATAGCACTAGCATATGGATCAGGAAGGTCCCCTTGGGCTAGCCAAGGATGTTGGAGACAGTCAACAGCTGACGCACGAGCTTCAGGCTTGCGAATGAGAAGTGCTTTGATGAAATCTATTGCAAAATCAAAAATGTCTTCAAAGTCCTCACTATTGTAAGTGACATTCAGCTGGGAAATATTTAGGAAGGTCTGCTGCTTGTCATCGCCCAAGAAAGGGGAGGTTCCTGTTAGCATAATGTATGCCAGTACACCAATACTCCACATGTCTGTTGCAATGCTGATTGGCTCATACCTGAAAATTTCAGGAGCAACATATTCTTGGGGTCCCCATAATTTCTCTTACCCTCCTCTTTGTTATTCAAAATTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGATGAAGTCTCCTGCTA