ORFeome > stk38 ORF1 – XORFeome v1.0

stk38 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: stk38
Gene ID: 5742627
Gene Page ID: 5742604
ORF Xenbase ID: 17299131

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056129
Original XGC clone length: 1398

Human orthology & disease relationships

NCBI Entrez ID: 11329
Ensembl gene IDs: ENSG00000112079
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 214150,216400,601675

Library Location

Plate ID: GDExl11020
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ824690
dbEST ID: 79642392
Trimmed Sequence: ATGGCAATGACAGAGCAAACTCCATGCTTCCCAATGAGTAACCACACAAAGGAGAGGGTCACCATGACCAAAATGACATTGGAAAACTTTTACAGTAACCTCATCACACAGCATGAGGAACGGGAATTTCGGCAGAAGAGACTAGAAAAAGCAATGGAAGAGGAAGGATTAAGGGATGAAGAGAAAAGGATGCGAAGGTCAGCTCATGCACGAAAAGAAACCGAGTTTCTAAGGCTAAAAAGGACAAGACTGGGACTGGAAGACTTTGAATCATTAAAAGTAATAGGAAGAGGTGCATTTGGAGAGGTCAGGCTGGTTCAAAAGAAAGACACAGGGCACGTCTATGCAATGAAGATATTACGGAAGACTGACATGCTTGAAAAAGAGCAGGTTGGACACATCCGCGCAGAACGAGACATTCTGGTGGAGGCCGACAGCTTGTGGGTGGTGAAAATGTTCTACAGTTTTCAGGACAAGCTAAACCTTTATCTCATCATGGAGTTCCTGCCAGGAGGGGATATGATGACATTGCTGATGAAGAAAGACACTCTAACAGAAGAAGAAACACAGTTTTACATTGCAGAGACTGTACTGGCAATTGATTCTATCCATCAACTTGGATTCATCCACAGGGATATTAAGCCTGATAACCTTCTCCCTGGACAGCAGGGACATGTAAAAGCTTCAGATTTTTGGGGTTATGTACTGGGACTAAAAAAGCTCATCGGGACTGATTTCTACAGGAAACTTTGACACAAGCCTGCCCAATTGATTTCCATTTTCAAAAAATGATTTCTAAGAAGGAAAGCAAAAACTTGGAAAAAGAAACCGAAGCCACCGGGCATTTTCCCCT
Full Trace Sequence: TTTTTAGACCTGGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAATGACAGAGCAAACTCCATGCTTCCCAATGAGTAACCACACAAAGGAGAGGGTCACCATGACCAAAATGACATTGGAAAACTTTTACAGTAACCTCATCACACAGCATGAGGAACGGGAATTTCGGCAGAAGAGACTAGAAAAAGCAATGGAAGAGGAAGGATTAAGGGATGAAGAGAAAAGGATGCGAAGGTCAGCTCATGCACGAAAAGAAACCGAGTTTCTAAGGCTAAAAAGGACAAGACTGGGACTGGAAGACTTTGAATCATTAAAAGTAATAGGAAGAGGTGCATTTGGAGAGGTCAGGCTGGTTCAAAAGAAAGACACAGGGCACGTCTATGCAATGAAGATATTACGGAAGACTGACATGCTTGAAAAAGAGCAGGTTGGACACATCCGCGCAGAACGAGACATTCTGGTGGAGGCCGACAGCTTGTGGGTGGTGAAAATGTTCTACAGTTTTCAGGACAAGCTAAACCTTTATCTCATCATGGAGTTCCTGCCAGGAGGGGATATGATGACATTGCTGATGAAGAAAGACACTCTAACAGAAGAAGAAACACAGTTTTACATTGCAGAGACTGTACTGGCAATTGATTCTATCCATCAACTTGGATTCATCCACAGGGATATTAAGCCTGATAACCTTCTCCCTGGACAGCAGGGACATGTAAAAGCTTCAGATTTTTGGGGTTATGTACTGGGACTAAAAAAGCTCATCGGGACTGATTTCTACAGGAAACTTTGACACAAGCCTGCCCAATTGATTTCCATTTTCAAAAAATGATTTCTAAGAAGGAAAGCAAAAACTTGGAAAAAGAAACCGAAGCCACCGGGCATTTTCCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAATGACAGAGCAAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ830042
dbEST ID: 79647744
Trimmed Sequence: CTTCCTTGGCTTGATGAAAGATGGGAGAGCCCCCCGTGCTGTAAGCCCTTCAAAGCGCTTATATGTGTAGTTGATAAAGACCCAGTCCTTGTTCTTGAACTCTGATTCAGGGTGGTTGCTTACAGCTCCCATTGGTTTAAGAATATCAGAATCAGGAAATTCATCAAAATTTGATGTGTCATCAATACTTTTAATTTCAATTGGAATAGCAGCAGGCCTTTCCCTAATATGTTCCCAGTCAACACCTTCAAAGAAAGGGTTTGTTTTGATCTCTTCTACACCGGGAGCACCAATTCGCTGCTCCCATTCACAGCAGAAGCGTAAAATAAGATCCTTGGCTTTTTCTGAAATCGGGACCTCCGGAGGAAATATAAGCGTTTCCTTCCAGTTCATGACTTTCTTGTATGTCTCCTGAGGTGTCTCAGAACAAAATGGAGGATAACCAATTAACATCTCGTACATGATTACCCCTAATGACCACCAATCACACAACTTGTTGTATCCAGTTTGAAGAAATACTTCAGGGGCAATGTAGTCTGGTGTTCCAACAGTGGAAAATGCCAGTTGGGCGTCGGTTTCTTTTTCAGGTTTCTGCTTTCCTCTTAGAATTCATANTTTGAAATTGAAATCACTTTGGCAGCTGTGGTTCAAGTTCCTGTAGAAATCAGTCCGATGAGCCCTTTTTAGTCCAGTACATAACCAAAAATCTGAAAACTTTTACAGGTCCCTTGCTTTCCCCGGGAAAAAGGTATCCGGGCTAAAAAACCCC
Full Trace Sequence: CCGAGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCCTTGGCTTGATGAAAGATGGGAGAGCCCCCCGTGCTGTAAGCCCTTCAAAGCGCTTATATGTGTAGTTGATAAAGACCCAGTCCTTGTTCTTGAACTCTGATTCAGGGTGGTTGCTTACAGCTCCCATTGGTTTAAGAATATCAGAATCAGGAAATTCATCAAAATTTGATGTGTCATCAATACTTTTAATTTCAATTGGAATAGCAGCAGGCCTTTCCCTAATATGTTCCCAGTCAACACCTTCAAAGAAAGGGTTTGTTTTGATCTCTTCTACACCGGGAGCACCAATTCGCTGCTCCCATTCACAGCAGAAGCGTAAAATAAGATCCTTGGCTTTTTCTGAAATCGGGACCTCCGGAGGAAATATAAGCGTTTCCTTCCAGTTCATGACTTTCTTGTATGTCTCCTGAGGTGTCTCAGAACAAAATGGAGGATAACCAATTAACATCTCGTACATGATTACCCCTAATGACCACCAATCACACAACTTGTTGTATCCAGTTTGAAGAAATACTTCAGGGGCAATGTAGTCTGGTGTTCCAACAGTGGAAAATGCCAGTTGGGCGTCGGTTTCTTTTTCAGGTTTCTGCTTTCCTCTTAGAATTCATANTTTGAAATTGAAATCACTTTGGCAGCTGTGGTTCAAGTTCCTGTAGAAATCAGTCCGATGAGCCCTTTTTAGTCCAGTACATAACCAAAAATCTGAAAACTTTTACAGGTCCCTTGCTTTCCCCGGGAAAAAGGTATCCGGGCTAAAAAACCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCCTTGGCTTGATGAAAGAT