ORFeome > stk39 ORF3 – XORFeome v1.0

stk39 ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: stk39
Gene ID: 5824599
Gene Page ID: 5824518
ORF Xenbase ID: 17299155

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127406
Original XGC clone length: 1587

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ838755
dbEST ID: 79656457
Trimmed Sequence: ATGTCAGAGCAGCAGCAGCAGGACCCCAGCTCCCTCCCATGGTCCATCAACAGGGACGACTATGAACTGCAGGAGGTCATTGGAAGCGGCGCGACGGCTGTGGTCCAGGCTGCTTTCTGCGCTCCCAAGAAAGAGAAAGTGGCCATCAAGAGAATAAACCTGGAGAAATGCCAGACCAGTATGGACGAACTTCTGAAAGAAATCCAGGCAATGAGCCAGTGCCATCATCCCAATATCGTCTCCTACTACACGTCGTTTGTGGTGAAGGATGAGCTGTGGCTGGTAATGAAGTTGATGAGCGGAGGTTCAGTGCTGGATATCATCAAACACATCGTTGCCAGAGGAGAACATAAGAACGGCGTTCTGGATGAAGCGAGCATTGCCACCATGTTAAAGGAGGTCCTTGAGGGACTCGAGTATCTGCATAAAAACGGACAGATCCACAGGGATGTGAAAGCTGGAAATATACTTCTGGGTGACGATGGATCTGTACAAATAGCAGACTTTGGTGTCAGCGCTTTCCTGTCCCCGGGGGGAGACATCACCAGAATAAAGTGCGGAAAACATTTGTTAGCCCCCCCTGCTGGATGGCTACAGAAGGTCTTGAACCAGGTTAAAAAGTAATGATGTTTAATCAGATATGGGGAATTTTTTGGTATTAGCGGGAAGAAGAATGGGCGACGTGGGGCGAGCCCGCCGATCATAGAAACGCCCCCTGCTGTAAGGTTTTTGATTGTTGATTTCGCCAGAGAGGATGCTCCGCAACCTTCCGCGAAGGTGGGAGGGTAGAGGGGAGGGGGGGATTGTGTACATAAGATATCTTTGAC
Full Trace Sequence: CTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGAGCAGCAGCAGCAGGACCCCAGCTCCCTCCCATGGTCCATCAACAGGGACGACTATGAACTGCAGGAGGTCATTGGAAGCGGCGCGACGGCTGTGGTCCAGGCTGCTTTCTGCGCTCCCAAGAAAGAGAAAGTGGCCATCAAGAGAATAAACCTGGAGAAATGCCAGACCAGTATGGACGAACTTCTGAAAGAAATCCAGGCAATGAGCCAGTGCCATCATCCCAATATCGTCTCCTACTACACGTCGTTTGTGGTGAAGGATGAGCTGTGGCTGGTAATGAAGTTGATGAGCGGAGGTTCAGTGCTGGATATCATCAAACACATCGTTGCCAGAGGAGAACATAAGAACGGCGTTCTGGATGAAGCGAGCATTGCCACCATGTTAAAGGAGGTCCTTGAGGGACTCGAGTATCTGCATAAAAACGGACAGATCCACAGGGATGTGAAAGCTGGAAATATACTTCTGGGTGACGATGGATCTGTACAAATAGCAGACTTTGGTGTCAGCGCTTTCCTGTCCCCGGGGGGAGACATCACCAGAATAAAGTGCGGAAAACATTTGTTAGCCCCCCCTGCTGGATGGCTACAGAAGGTCTTGAACCAGGTTAAAAAGTAATGATGTTTAATCAGATATGGGGAATTTTTTGGTATTAGCGGGAAGAAGAATGGGCGACGTGGGGCGAGCCCGCCGATCATAGAAACGCCCCCTGCTGTAAGGTTTTTGATTGTTGATTTCGCCAGAGAGGATGCTCCGCAACCTTCCGCGAAGGTGGGAGGGTAGAGGGGAGGGGGGGATTGTGTACATAAGATATCTTTGAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGAGCAGCAGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838754
dbEST ID: 79656456
Trimmed Sequence: GCGATACTGAGCTGCGCAAAACCTACAAGCTTCCCGTCATCCGGAATGTCAGAAGGATCCACTCCAGAGGCCAATTTGAATGTAACAGATCTGTTTGTCTGAGGTTCATCGACAATCTTCTGCAAATTGGCCGCAACTATTACTAAATCTCTGCCATCTACAAGGCCAGCCGAGACAAGTTCCTGCGATACGCCGTCTGCTGTATCTCTTCCTGGGGTAAACTCAAATCGAATATCATTCAGTTCTTTCTTTGTATTCCTTAATCGTAATACTAAGCTGATGGCGGCTTTTGCTTCTTCTTGTGCAGGAGGTGCAGCAGCTGCAAGAGTCGCCTGCCCAGAAGGAGGGACTGGGACAGACACCTGGGAAGGCGGAGCTTGTCCAGCTGGCTGAGGTAGATGAACAGAGGGCTGTGCTGGAGTCTGAAGATATGATGCTGAAGGCTCTGTTGCAGGAAAAAGCTCTGAGTTTTGTAATGAATCCTTTACACGTGGAGACCTAAGCTGTAATACGGCCGCTTTTCCCTCTTCACTCTCTTCATCCAGCTCGTCGTCGCTCCATTCCCAGCCGCCATCTTCTGTTTTATGGAGCCGACCACTTGAACCCGGCACTCTCCTGACCTTTTTGCCCCTCTCTGCTATGGTGGGGCCCTTTCTGCACCAGCCTTTCCTGCAAGAACTCTTTATTTCTTACCTTTTCTGGAGAACTTGGTGCTTCAAACAGTTTCGGGCTGAATGTGGGGCCCTCTTTCTCCGG
Full Trace Sequence: GAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGATACTGAGCTGCGCAAAACCTACAAGCTTCCCGTCATCCGGAATGTCAGAAGGATCCACTCCAGAGGCCAATTTGAATGTAACAGATCTGTTTGTCTGAGGTTCATCGACAATCTTCTGCAAATTGGCCGCAACTATTACTAAATCTCTGCCATCTACAAGGCCAGCCGAGACAAGTTCCTGCGATACGCCGTCTGCTGTATCTCTTCCTGGGGTAAACTCAAATCGAATATCATTCAGTTCTTTCTTTGTATTCCTTAATCGTAATACTAAGCTGATGGCGGCTTTTGCTTCTTCTTGTGCAGGAGGTGCAGCAGCTGCAAGAGTCGCCTGCCCAGAAGGAGGGACTGGGACAGACACCTGGGAAGGCGGAGCTTGTCCAGCTGGCTGAGGTAGATGAACAGAGGGCTGTGCTGGAGTCTGAAGATATGATGCTGAAGGCTCTGTTGCAGGAAAAAGCTCTGAGTTTTGTAATGAATCCTTTACACGTGGAGACCTAAGCTGTAATACGGCCGCTTTTCCCTCTTCACTCTCTTCATCCAGCTCGTCGTCGCTCCATTCCCAGCCGCCATCTTCTGTTTTATGGAGCCGACCACTTGAACCCGGCACTCTCCTGACCTTTTTGCCCCTCTCTGCTATGGTGGGGCCCTTTCTGCACCAGCCTTTCCTGCAAGAACTCTTTATTTCTTACCTTTTCTGGAGAACTTGGTGCTTCAAACAGTTTCGGGCTGAATGTGGGGCCCTCTTTCTCCGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGATACTGAGCTGCGCAA