ORFeome > stk4 ORF2 – XORFeome v1.0

stk4 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256477
Gene Page ID:
ORF Xenbase ID: 17299167

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123162
Original XGC clone length: 888

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ838147
dbEST ID: 79655849
Trimmed Sequence: ATGGAGACTGTACAGCTAAGGAAGAACCCCAGGAGACATCTGAAGAAGCTGAGTGAAGAAAGTCTCAATAAGCAGCCGGAAGAAGTGTTTGATGTCCTCGAGAAACTTGGGGAAGGGTCCTATGGCAGCGTATATAAAGCGAGCCACAAAGAAACAAGCCAGATTGTTGCCATTAAGCAGATTCCCGTGGAGTCTGACCTTCAAGAGATTATTAAGGAAATTGCCATCATGCAGCAGTGTGATAGCCCGCATGTGGTGAAATACTATGGGAGTTATTTTAAAAACACAGATCTGTGGATCGTAATGGAGTTCTGTGGAGGGGGATCCGTCTCTGACATTATCCGACTCCGGAAACAGACGTTAAAAGAGGATGAAATTGCAACTATTCTGCAGTCGACCCTCAAGGGACTGGAGTATCTTCACTTTATGAGAAAGATTCACCGAGACATAAAGGCTGGGAATATATTGCTGAGTTCTGAAGGCACCGCCAAGCTGGCTGACTTTGGAGTGGCTGGGCAGCTCACAGATACAATGGCGAAGCGCAGCACAGTCATCGGGACGCCGTTTTGGATGGCTGCAGAAGTGATCCAGGAGATCGGATATAATTGCGTGGCTGACGGCTAATCCCTCGGTATCACCGGCAATGAAATGTGGGAAGGGGAACGGGGGAAGCCAAAATTCTTCCAATTACGGCAAGAGTGAGGATCCCTTCGAGGCGGCCCCCCCCTTTACAAAGACGGGAAACGGGGCCGGGGGGTTGGGGGGGGG
Full Trace Sequence: TCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGACTGTACAGCTAAGGAAGAACCCCAGGAGACATCTGAAGAAGCTGAGTGAAGAAAGTCTCAATAAGCAGCCGGAAGAAGTGTTTGATGTCCTCGAGAAACTTGGGGAAGGGTCCTATGGCAGCGTATATAAAGCGAGCCACAAAGAAACAAGCCAGATTGTTGCCATTAAGCAGATTCCCGTGGAGTCTGACCTTCAAGAGATTATTAAGGAAATTGCCATCATGCAGCAGTGTGATAGCCCGCATGTGGTGAAATACTATGGGAGTTATTTTAAAAACACAGATCTGTGGATCGTAATGGAGTTCTGTGGAGGGGGATCCGTCTCTGACATTATCCGACTCCGGAAACAGACGTTAAAAGAGGATGAAATTGCAACTATTCTGCAGTCGACCCTCAAGGGACTGGAGTATCTTCACTTTATGAGAAAGATTCACCGAGACATAAAGGCTGGGAATATATTGCTGAGTTCTGAAGGCACCGCCAAGCTGGCTGACTTTGGAGTGGCTGGGCAGCTCACAGATACAATGGCGAAGCGCAGCACAGTCATCGGGACGCCGTTTTGGATGGCTGCAGAAGTGATCCAGGAGATCGGATATAATTGCGTGGCTGACGGCTAATCCCTCGGTATCACCGGCAATGAAATGTGGGAAGGGGAACGGGGGAAGCCAAAATTCTTCCAATTACGGCAAGAGTGAGGATCCCTTCGAGGCGGCCCCCCCCTTTACAAAGACGGGAAACGGGGCCGGGGGGTTGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGACTGTACAGCTAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838146
dbEST ID: 79655848
Trimmed Sequence: GTGATATACAGAACAAGATACAGTTATAGTGGATTCGGATTTGGTCTCTGTTACCAGCAGTAGCTCCGTGGCACTGGACCTCAGTTCAGGGTTCTTCACAAGACATAAATTAATGAAGTCCACAAAATCCTTGGACCAGAGTTCGGGTTTTCTAAATGTAGGGGGCGGGTTGGAAGGTATCATGAATATTGCCCTCATTGGATGAATTTCTGCATATGGGGGTTTTCCTTCCGCCATTTCAATTGCGGTGATACCGAGGGACCAGATGTCAGCCACGCAATTATATCCGATTTCCTGGATCACTTCTGGAGCCATCCAAAATGGCGTCCCGATGACTGTGTTGCGCTTTGCCATTGTATCTGTGAGCTGCCCAGCCACTCCAAAGTCAGCCAGCTTGGCGGTGCCTTCAGAACTCAACAATATATTCCCACCCTTTATGTCTCGGTGAGTCGTTCTCATAAAGTGAAGATGCGCCACTCCCTTGAGGGTCGAGTGCAGAGTAGTTGCAATTTCATCCTCTTTTACGTCCGTTTCGGGAGTCGGAGAAGGTCAAAAAAAATCCCCCTCCCCACAACTCCCTTACCACCCCCACATCGTGTTTTTAAAGAATATCAAAAATATTTCCCTCATGCGGGCTATCGGGGGGCTGGATGATGGGCAGTTCCGTAAGACCTTCTTTAAAAGTCAAAACCCCAAAGGAGAAACACCTTAAAGGGGAAGCAGTTTGAGGGTGGGTTCCTTTTTGGGGGCGTGGCTTTTGACTA
Full Trace Sequence: GGGTAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGATATACAGAACAAGATACAGTTATAGTGGATTCGGATTTGGTCTCTGTTACCAGCAGTAGCTCCGTGGCACTGGACCTCAGTTCAGGGTTCTTCACAAGACATAAATTAATGAAGTCCACAAAATCCTTGGACCAGAGTTCGGGTTTTCTAAATGTAGGGGGCGGGTTGGAAGGTATCATGAATATTGCCCTCATTGGATGAATTTCTGCATATGGGGGTTTTCCTTCCGCCATTTCAATTGCGGTGATACCGAGGGACCAGATGTCAGCCACGCAATTATATCCGATTTCCTGGATCACTTCTGGAGCCATCCAAAATGGCGTCCCGATGACTGTGTTGCGCTTTGCCATTGTATCTGTGAGCTGCCCAGCCACTCCAAAGTCAGCCAGCTTGGCGGTGCCTTCAGAACTCAACAATATATTCCCACCCTTTATGTCTCGGTGAGTCGTTCTCATAAAGTGAAGATGCGCCACTCCCTTGAGGGTCGAGTGCAGAGTAGTTGCAATTTCATCCTCTTTTACGTCCGTTTCGGGAGTCGGAGAAGGTCAAAAAAAATCCCCCTCCCCACAACTCCCTTACCACCCCCACATCGTGTTTTTAAAGAATATCAAAAATATTTCCCTCATGCGGGCTATCGGGGGGCTGGATGATGGGCAGTTCCGTAAGACCTTCTTTAAAAGTCAAAACCCCAAAGGAGAAACACCTTAAAGGGGAAGCAGTTTGAGGGTGGGTTCCTTTTTGGGGGCGTGGCTTTTGACTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGATATACAGAACAAGATACAGT