ORFeome > stmn1 ORF1 – XORFeome v1.0

stmn1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: stmn1
Gene ID: 481619
Gene Page ID: 481614
ORF Xenbase ID: 17299173

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054159
Original XGC clone length: 438

Human orthology & disease relationships

NCBI Entrez ID: 3925
Ensembl gene IDs: ENSG00000117632
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,259500,609048

Library Location

Plate ID: GDExl11001
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ839233
dbEST ID: 79656935
Trimmed Sequence: ATGTGTGACTCTGATATTAAAGTAAAAGAGCTGGAAAAGCGTGCTTCTGGTCAAGCATTTGAGCTAATATTGAGTCCTCCTTCTATGGATGCTGCACCAGATCTTTCCATTGCTTCACCCAAGAAGAAGGAATGCTCCTTGGAAGAAATTCAGAAGAAACTAGAAGCTGCAGAAGAAAGGCGCAAATTGCATGAAGCTGAAATATTGAAGCAGCTTGCTGAAAAGCGAGAACATGAGAAGGAGGTCCTACAAAAGGCTATTGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAAAAGCTAACTACAAAAATGGAAGCCATTAAGGAAAATAGAGAGGCTCAGATGGCTGCAAAGTTGGAAAGGTTGCGAGAGAAGGATAAAAAATTGGAAGAAATCAGAAAGGGGAAAGAATGCAAAGAACCTTCTGAGGACTT
Full Trace Sequence: GGGCCTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGTGACTCTGATATTAAAGTAAAAGAGCTGGAAAAGCGTGCTTCTGGTCAAGCATTTGAGCTAATATTGAGTCCTCCTTCTATGGATGCTGCACCAGATCTTTCCATTGCTTCACCCAAGAAGAAGGAATGCTCCTTGGAAGAAATTCAGAAGAAACTAGAAGCTGCAGAAGAAAGGCGCAAATTGCATGAAGCTGAAATATTGAAGCAGCTTGCTGAAAAGCGAGAACATGAGAAGGAGGTCCTACAAAAGGCTATTGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAAAAGCTAACTACAAAAATGGAAGCCATTAAGGAAAATAGAGAGGCTCAGATGGCTGCAAAGTTGGAAAGGTTGCGAGAGAAGGATAAAAAATTGGAAGAAATCAGAAAGGGGAAAGAATGCAAAGAACCTTCTGAGGACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCAAACAAATCAAGCCCGTGTCTCAAAATCTCTAAAGTACAGGCGGGGGGTGGGTTTCCTGGTTCGCGGGCTCCTTGGGGGGCGGGGGGCCCCCTTGTGTTCCGGTGGAAAAAAAAAACCCGCGAAAAAAAAAGGTTCGAACGGAGGTGCGAGGAAAAAAGGGCAGCCAGGGCGGCGAGGGGGGGGGAACCTTATAGCAAGGTCTGGCAGGGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTGACTCTGATATTAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839232
dbEST ID: 79656934
Trimmed Sequence: GTCCTCAGAAGGTTCTTTGCATTCTTTCCCCTTTCTGATTTCTTCCAATTTTTTATCCTTCTCTCGCAACCTTTCCAACTTTGCAGCCATCTGAGCCTCTCTATTTTCCTTAATGGCTTCCATTTTTGTAGTTAGCTTTTCTTCTGCCATTTTACTGAAGTTGTTGTTCTCTTCAATAGCCTTTTGTAGGACCTCCTTCTCATGTTCTCGCTTTTCAGCAAGCTGCTTCAATATTTCAGCTTCATGCAATTTGCGCCTTTCTTCTGCAGCTTCTAGTTTCTTCTGAATTTCTTCCAAGGAGCATTCCTTCTTCTTGGGTGAAGCAATGGAAAGATCTGGTGCAGCATCCATAGAAGGAGGACTCAATATTAGCTCCAATGCTTGACCAGAAGCACGCTTTTCCAGCTCTTTTACTTTAATATCAGAGTCACACATGG
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCCTCAGAAGGTTCTTTGCATTCTTTCCCCTTTCTGATTTCTTCCAATTTTTTATCCTTCTCTCGCAACCTTTCCAACTTTGCAGCCATCTGAGCCTCTCTATTTTCCTTAATGGCTTCCATTTTTGTAGTTAGCTTTTCTTCTGCCATTTTACTGAAGTTGTTGTTCTCTTCAATAGCCTTTTGTAGGACCTCCTTCTCATGTTCTCGCTTTTCAGCAAGCTGCTTCAATATTTCAGCTTCATGCAATTTGCGCCTTTCTTCTGCAGCTTCTAGTTTCTTCTGAATTTCTTCCAAGGAGCATTCCTTCTTCTTGGGTGAAGCAATGGAAAGATCTGGTGCAGCATCCATAGAAGGAGGACTCAATATTAGCTCCAATGCTTGACCAGAAGCACGCTTTTCCAGCTCTTTTACTTTAATATCAGAGTCACACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGAAAACCCGACCTAAAAACTGGCCCGTCTGTTACAACTCTTGGACTGGGCAGTTTCCTGGCAGCTCTGGGCCCGTATCGCAAATTGTCGGTTTTTAAAANNTNNNAAAAAAAAAAAACAACTAAAAAAAAAAAAAACCTCAAGAGACTATTANATNNGGAGANNAGGGGNCCCCCNNGGGGGGAANANAANNAANNNAAANNNAGGANAGNNCGNNNTNAGTGGGAGNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTCAGAAGGTTCTTTGCAT