ORFeome > stmn4 ORF2 – XORFeome v1.0

stmn4 ORF2 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: stmn4
Gene ID: 1009077
Gene Page ID: 1009071
ORF Xenbase ID: 17299215

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078521
Original XGC clone length: 570

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ839912
dbEST ID: 79657614
Trimmed Sequence: ATGACTCTAGCAGCCTATAAAGAGAAGATAAAGGAGCTCCCCCTCGTGTCCATTTTCTGTTCCTGTTTCCTCTCTGATCCTTTAAAGACACAGACTAACAAGTATGATGCAGACACTGTGGACCTTACTTGGTGTGCTATTTCAGACATGGAGGTGATAGAATTAAACAAGAGAGCCTCTGGCCATGCCTTCGAGGTTATCCTGAAACCCCCTTCCTTTGATGGGATTCCAGAGATCACAGCCATCCTGCCCCAGAAGCGAGACCCTTCTCTAGAGGAGATCCAGAAGAAACTAGAGGCTGCCGAAGAAAGGCGCAAGTATCAGGAGGCAGAACTCCTCAAGCACCTGGCAGAAAAGAGAGAACATGAGCGCGAAGTCATACAGAAAGCCATTGAAGAGAACAACAACTTTAGCAAGATGGCCAAGGAGAAGCTGGCTCAGAGAATGGAGGTCAATAAGGAGAACAGGGAAGCCCACCTAGCAGCCATGCTTGAGCGTCTGCAGGAGAAGGATAAACATGCAGAAGAAGTGAGGAAAAACAAAGAACTGAAGGAAGAAGCTTCAAGGTT
Full Trace Sequence: AGACACACAATAATAGATTTTATCTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTCTAGCAGCCTATAAAGAGAAGATAAAGGAGCTCCCCCTCGTGTCCATTTTCTGTTCCTGTTTCCTCTCTGATCCTTTAAAGACACAGACTAACAAGTATGATGCAGACACTGTGGACCTTACTTGGTGTGCTATTTCAGACATGGAGGTGATAGAATTAAACAAGAGAGCCTCTGGCCATGCCTTCGAGGTTATCCTGAAACCCCCTTCCTTTGATGGGATTCCAGAGATCACAGCCATCCTGCCCCAGAAGCGAGACCCTTCTCTAGAGGAGATCCAGAAGAAACTAGAGGCTGCCGAAGAAAGGCGCAAGTATCAGGAGGCAGAACTCCTCAAGCACCTGGCAGAAAAGAGAGAACATGAGCGCGAAGTCATACAGAAAGCCATTGAAGAGAACAACAACTTTAGCAAGATGGCCAAGGAGAAGCTGGCTCAGAGAATGGAGGTCAATAAGGAGAACAGGGAAGCCCACCTAGCAGCCATGCTTGAGCGTCTGCAGGAGAAGGATAAACATGCAGAAGAAGTGAGGAAAAACAAAGAACTGAAGGAAGAAGCTTCAAGGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGAAATCCCCTATAATAAGTCATATAACATGAACAAAAAAGGTTTCCTGGCATCTCTGGGCCTGTCCAGAAACGCCCCCAAAATTTAAAAACAACGGGGGGGGGGGGGGAAGGGGGCGCGGGGATTATATTTGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCTAGCAGCCTATAAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839911
dbEST ID: 79657613
Trimmed Sequence: CCTTGAAGCTTCTTCCTTCAGTTCTTTGTTTTTCCTCACTTCTTCTGCATGTTTATCCTTCTCCTGCAGACGCTCAAGCATGGCTGCTAGGTGGGCTTCCCTGTTCTCCTTATTGACCTCCATTCTCTGAGCCAGCTTCTCCTTGGCCATCTTGCTAAAGTTGTTGTTCTCTTCAATGGCTTTCTGTATGACTTCGCGCTCATGTTCTCTCTTTTCTGCCAGGTGCTTGAGGAGTTCTGCCTCCTGATACTTGCGCCTTTCTTCGGCAGCCTCTAGTTTCTTCTGGATCTCCTCTAGAGAAGGGTCTCGCTTCTGGGGCAGGATGGCTGTGATCTCTGGAATCCCATCAAAGGAAGGGGGTTTCAGGATAACCTCGAAGGCATGGCCAGAGGCTCTCTTGTTTAATTCTATCACCTCCATGTCTGAAATAGCACACCAAGTAAGGTCCACAGTGTCTGCATCATACTTGTTAGTCTGTGTCTTTAAAGGATCAGAGAGGAAACAGGAACAGAAAATGGACACGAGGGGGAGCTCCTTTATCTTCTCTTTATAGGCTGCTAGAGTCATGG
Full Trace Sequence: GAAAATGTCTATTGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCTTGAAGCTTCTTCCTTCAGTTCTTTGTTTTTCCTCACTTCTTCTGCATGTTTATCCTTCTCCTGCAGACGCTCAAGCATGGCTGCTAGGTGGGCTTCCCTGTTCTCCTTATTGACCTCCATTCTCTGAGCCAGCTTCTCCTTGGCCATCTTGCTAAAGTTGTTGTTCTCTTCAATGGCTTTCTGTATGACTTCGCGCTCATGTTCTCTCTTTTCTGCCAGGTGCTTGAGGAGTTCTGCCTCCTGATACTTGCGCCTTTCTTCGGCAGCCTCTAGTTTCTTCTGGATCTCCTCTAGAGAAGGGTCTCGCTTCTGGGGCAGGATGGCTGTGATCTCTGGAATCCCATCAAAGGAAGGGGGTTTCAGGATAACCTCGAAGGCATGGCCAGAGGCTCTCTTGTTTAATTCTATCACCTCCATGTCTGAAATAGCACACCAAGTAAGGTCCACAGTGTCTGCATCATACTTGTTAGTCTGTGTCTTTAAAGGATCAGAGAGGAAACAGGAACAGAAAATGGACACGAGGGGGAGCTCCTTTATCTTCTCTTTATAGGCTGCTAGAGTCATGGTGCCAACTTTTTTGTACAAATTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGACAGGTCACTATCAGTCAAAATAAAATCATTTATTTGGGGTCCCGACCTAATACCGGCCGTCATTAGCACACCCCTTGTTTACAAAGGGGGGGTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTTGAAGCTTCTTCCTTCAGT