ORFeome > stom ORF1 – XORFeome v1.0

stom ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: stom
Gene ID: 995464
Gene Page ID: 995462
ORF Xenbase ID: 17299221

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042356
Original XGC clone length: 846

Human orthology & disease relationships

NCBI Entrez ID: 2040
Ensembl gene IDs: ENSG00000148175
Directly associated (OMIM) disease MIM numbers: 185000
Indirectly associated (Lage, et al.) disease MIM numbers: 235700,600858,606777

Library Location

Plate ID: GDExl11008
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ823648
dbEST ID: 79641350
Trimmed Sequence: ATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGNCAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCCTGAAGAAGCCTCCATGGTCCTCTCCGATTCCCCAGCCGCCCTGCAACTGCGCTACCTACAAACGCTGAACACCATCCCCCCCTAAGAAAAAACTCCACCATTCCGTCCTTCCCTTCCGC
Full Trace Sequence: GGCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGACAACACCGAGCTCAAGTCCAGGAGGGAAAACCCAGATTCCAGGAATTTTGCTATTTCGGAGGGCGGGCTTGGATGCTGCGGCTGGTGTTTGGTGATTCTGTCCTTCATCTTCACAATCCTCACCCTCCCCATATCAATATGGATGTGCATAAAGATTATTAAGGAATATGAACGAGCTATCATTTTCAGACTCGGACGTATCCTGCAAGGTGGAGCAAAGGGACCAGGTCTGTTCTTCGTTCTCCCCTGCACTGACAGCTTCATCAATGTGGATATGAGGACCATTTCATTTGACATCCCTCCCCAAGAGATCCTGACAAAGGACTCAGTCACCGTCAGTGTAGATGGCGTTGTCTACTACCGGGTCAATGATGCTACCCTGGCAGTGGCAAATATTACCAACGCAGACTCTGCCACCCGTCTCCTGGCTCAGACCACCTTGAGAAATGTCTTGGGGACTAAGAACCTGTCCCAGATCCTCTCTGACAGAGAAGAGATTGCCCATAACATGCAATCCACGCTGGATGTTGCAACAGATGACTGGGGTATCAAGGTGGAGCGAGTAGAGATTAAGGATGTGAAGCTGCCCATTCAGTTGCAGAGAGCGATGGCGGCAGAAGCAGAGGCTGNCAGGGAAGCCCGAGCCAAGGTCATAGCAGCAGAGGGGGAGATGAACGCCTCCCGTGCCCCTGAAGAAGCCTCCATGGTCCTCTCCGATTCCCCAGCCGCCCTGCAACTGCGCTACCTACAAACGCTGAACACCATCCCCCCCTAAGAAAAAACTCCACCATTCCGTCCTTCCCTTCCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGACAACACCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ828954
dbEST ID: 79646656
Trimmed Sequence: TTTTTTCATCAGTCCGTTCAGCAGGTCGATGGGCAGAGGGAAGACGATGGTGGAGTTCTTCTCAGAGGCGATGGTGGTCAGCGTTTGTAGGTAGCGCAGCTGCAGGGCGGCTGGGGATTCGGAGAGGACCATGGAGGCTTCTTTCAGGGCACGGGAGGCGTTCATCTCCCCCTCTGCTGCTATGACCTTGGCTCGGGCTTCCCTTGCAGCCTCTGCTTCTGCCGCCATCGCTCTCTGCAACTGAATGGGCAGCTTCACATCCTTAATCTCTACTCGCTCCACCTTGATACCCCAGTCATCTGTTGCAACATCCAGCGTGGATTGCATGTTATGGGCAATCTCTTCTCTGTCAGAGAGGATCTGGGACAGGTTCTTAGTCCCCAAGACATTTCTCAAGGTGGTCTGAGCCAGGAGACGGGTGGCAGAGTCTGCGTTGGTAATATTTGCCACTGCCAGGGTAGCATCATTGACCCGGTAGTAGACAACGCCATCTACACTGACGGTGACTGAGTCCTTTGTCAGGATCTCTTGGGGGAGGGATGTCAAATGAAATGGTCCTCATATCCACATTGATGAAGCTGTCAGTGCAGGGGAGAACGAAGAACAGACCTGGTCCCTTTGCTCCACCTTGCAGGATACGTCCGAGTCTGAAAATGATAGCTCGTTCATATTCCTAAATAATCTTTATGCCATCCTATTGAAAGGGGGGGGGGGGGGGGAGGGATTGGGGGAAGAATGAAAGGAAAAGAAATCACCCCAAACCCCCAAC
Full Trace Sequence: CCGTGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGAAATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTTTCATCAGTCCGTTCAGCAGGTCGATGGGCAGAGGGAAGACGATGGTGGAGTTCTTCTCAGAGGCGATGGTGGTCAGCGTTTGTAGGTAGCGCAGCTGCAGGGCGGCTGGGGATTCGGAGAGGACCATGGAGGCTTCTTTCAGGGCACGGGAGGCGTTCATCTCCCCCTCTGCTGCTATGACCTTGGCTCGGGCTTCCCTTGCAGCCTCTGCTTCTGCCGCCATCGCTCTCTGCAACTGAATGGGCAGCTTCACATCCTTAATCTCTACTCGCTCCACCTTGATACCCCAGTCATCTGTTGCAACATCCAGCGTGGATTGCATGTTATGGGCAATCTCTTCTCTGTCAGAGAGGATCTGGGACAGGTTCTTAGTCCCCAAGACATTTCTCAAGGTGGTCTGAGCCAGGAGACGGGTGGCAGAGTCTGCGTTGGTAATATTTGCCACTGCCAGGGTAGCATCATTGACCCGGTAGTAGACAACGCCATCTACACTGACGGTGACTGAGTCCTTTGTCAGGATCTCTTGGGGGAGGGATGTCAAATGAAATGGTCCTCATATCCACATTGATGAAGCTGTCAGTGCAGGGGAGAACGAAGAACAGACCTGGTCCCTTTGCTCCACCTTGCAGGATACGTCCGAGTCTGAAAATGATAGCTCGTTCATATTCCTAAATAATCTTTATGCCATCCTATTGAAAGGGGGGGGGGGGGGGGAGGGATTGGGGGAAGAATGAAAGGAAAAGAAATCACCCCAAACCCCCAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTTCATCAGTCCGTTCAGCA