ORFeome > stx6 ORF2 – XORFeome v1.0

stx6 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: stx6
Gene ID: 6078729
Gene Page ID: 1015933
ORF Xenbase ID: 17299353

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108776
Original XGC clone length: 420

Human orthology & disease relationships

NCBI Entrez ID: 10228
Ensembl gene IDs: ENSG00000135823
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 609528

Library Location

Plate ID: GDExl11085
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ837677
dbEST ID: 79655379
Trimmed Sequence: ATGTCGATGGAAGATCCGTTCTTCGTTGTGAGAGGGGAAGTACAGAAAGCGGTGAACACTGCTCAGGGCTTGTTTCAGCGATGGACAGACCTTTTGCAGGATCCATCTATTTCTACAAGAGAAGAACTGGACTGGACAACCAATGAATTGCGCAACAACCTCAGGAGCATTGAGTGGGATCTGGAAGACCTGGATGAGACCATTAGTATTGTGGAGTCCAATCCAAGGAAGTTTAGTCTGGATCCAGCTGAACTGAGACAAAGAAAAGCCTTCATCAATGATACGCGTCAGTGTGTAAAGGACATGAAGGATAGGATGACAAGCCCTTCTGTGCAAGCACTGACTGAGAAAAAGAACAGACAGGCCCTTTTTAGGAGAGGGGACAAAGCATGGCTGGAATCTCGAAACAGAAAAATATT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGATGGAAGATCCGTTCTTCGTTGTGAGAGGGGAAGTACAGAAAGCGGTGAACACTGCTCAGGGCTTGTTTCAGCGATGGACAGACCTTTTGCAGGATCCATCTATTTCTACAAGAGAAGAACTGGACTGGACAACCAATGAATTGCGCAACAACCTCAGGAGCATTGAGTGGGATCTGGAAGACCTGGATGAGACCATTAGTATTGTGGAGTCCAATCCAAGGAAGTTTAGTCTGGATCCAGCTGAACTGAGACAAAGAAAAGCCTTCATCAATGATACGCGTCAGTGTGTAAAGGACATGAAGGATAGGATGACAAGCCCTTCTGTGCAAGCACTGACTGAGAAAAAGAACAGACAGGCCCTTTTTAGGAGAGGGGACAAAGCATGGCTGGAATCTCGAAACAGAAAAATATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGAAAAAAAAACACGTGTCTCAAAATCTCTGATGTTACAGGGCGCGCGGGGGGAAAAAAACACAATTCCTTCCTCCCAAAGGGGGCCGTGTGGTTTCCCCGTGGGAAAGAAAAAAAACAAACAACAAGAAAAAAAAAAACGGGGGGGGGCGTAATAAAATTGGAAAAAGGAGGGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGATGGAAGATCCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837676
dbEST ID: 79655378
Trimmed Sequence: TATTTTTCTGTTTCGAGATTCCAGCCATGCTTTGTCCCCTCTCCTAAAAAGGGCCTGTCTGTTCTTTTTCTCAGTCAGTGCTTGCACAGAAGGGCTTGTCATCCTATCCTTCATGTCCTTTACACACTGACGCGTATCATTGATGAAGGCTTTTCTTTGTCTCAGTTCAGCTGGATCCAGACTAAACTTCCTTGGATTGGACTCCACAATACTAATGGTCTCATCCAGGTCTTCCAGATCCCACTCAATGCTCCTGAGGTTGTTGCGCAATTCATTGGTTGTCCAGTCCAGTTCTTCTCTTGTAGAAATAGATGGATCCTGCAAAAGGTCTGTCCATCGCTGAAACAAGCCCTGAGCAGTGTTCACCGCTTTCTGTACTTCCCCTCTCACAACGAAGAACGGATCTTCCATCGACATGG
Full Trace Sequence: CCGGCCGGGCAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATTTTTCTGTTTCGAGATTCCAGCCATGCTTTGTCCCCTCTCCTAAAAAGGGCCTGTCTGTTCTTTTTCTCAGTCAGTGCTTGCACAGAAGGGCTTGTCATCCTATCCTTCATGTCCTTTACACACTGACGCGTATCATTGATGAAGGCTTTTCTTTGTCTCAGTTCAGCTGGATCCAGACTAAACTTCCTTGGATTGGACTCCACAATACTAATGGTCTCATCCAGGTCTTCCAGATCCCACTCAATGCTCCTGAGGTTGTTGCGCAATTCATTGGTTGTCCAGTCCAGTTCTTCTCTTGTAGAAATAGATGGATCCTGCAAAAGGTCTGTCCATCGCTGAAACAAGCCCTGAGCAGTGTTCACCGCTTTCTGTACTTCCCCTCTCACAACGAAGAACGGATCTTCCATCGACATGGTGCCGACTTTTTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGAAAGAAACAACATAAACATAATCGCGAAAGCAGGGGAACGGCCGGGCATGAAAAGGCCCGAAGGCCCTGTGGCCGAAGGTGGCTGTGAGTTACATCTTTGTGGCGGAGGAAGGCCCGCAGCAGAAGGACAAACCCCGGGTCAGTGAATAAAGGGGTTGGCGGGCCCGGAGGCGGCGGGGGCATTGGTCAAAAACTTGGGGAGAAAGGAGGGGAGGGGAAGGGGAGAAGAAAGAATTACTCGCGGTGGAAGAGGAAGTGGAAGGGGGGGGAGAAACGGAGGGGGAGGGGAGGAGAGGGAGGGAGGAGAAAGGAGGGAAGAGTANGGAGAGGTCGGGGGGNGGAGAGGGAGGGGAGGAAAAGCGGAGNCAGGGGGGAGAGAGGGAGGAAGAAGGGGGGGAGGAGAGGGGGGAGAGGGAGGAAAGAGAGGGGAGAGAGGGGAGGAGGGGAGAGGAGGANGAAGACGAGAGGGGGGGGGAGGGGGGGGGNAGGGAAGGGGGGGGGGGAAGAAAAAGAAAAAAAGGNNAGAGGGGAAGAGAGNGAAGGGGGAGGAAGGGAGNAGGNGAAGACGAGNAGAGAGGGAGAGGGGGGAGAGGGGGGAGGGGGGGGGGAGGAGGGAGAGGGGNGAGAGGAGGAGGGGGGAGGGGGAGTGGGGGAGAGCGNGGANGAGAGGGAGACAAGGGGGAGATGAGGGGAGAANNAGGAGGANGAGCAGGGAGGANNGGGGGGAGNGGGGAGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTTTTCTGTTTCGAGATTCCAG