ORFeome > styx ORF2 – XORFeome v1.0

styx ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: styx
Gene ID: 967350
Gene Page ID: 967346
ORF Xenbase ID: 17299395

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097811
Original XGC clone length: 672

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ838353
dbEST ID: 79656055
Trimmed Sequence: ATGGAGGACGTGAAGTTGCAGTTCCCTTCTCTGCCCCTGTGCAAGGAAGAAGCTGAGGACTGGGCCTATCCAATGAGAAGGGAAATGCAGGAAATTTTACCTGGCTTATTTTTGGGTCCATATTCAGCAGCAATGAAAAGCAAGCTCTCCGTATTTCAGAAATGTGGCATAACCCATGTCATCTGCATCAGACAAAACATTGAAGCTAATTTTATTAAACCAAACTTTCAGCAGTTATTTCGGTACTTAGTTCTGGACATTGCCGATAATCCAGTTGAAAACATAATTCGCTTTTTCCCAATGTCCAAGGAATTTATTGATGGATGTTTACAAACTGGAGGAAAGGTCCTTATCCACGGCAATGCAGGGATCTCTAGAAGTGCCGCCTTAGTAATTGCTTATATAATGGAAACCTTTGGAATAAAATACAGGGATGCCTTTACATATGTCCAGGAAAGAAGATTCTGTATCAATCCCAATGCTGGATTTGTTCACCAGCTTCAGGAATATGAAGCCATCTATCTAGCAGAGTTAACCATCAAAATGATGTCCCCTCTGCAGCTGGGAAGGCCGTTGTGTATACAGTCTGGTGCTACTGGAAGTCTCAAAAGGACACTTGATGATGAAGATGAACTTGGAAACATGCAAGTGTCTGCAGCCCATGAAGGATT
Full Trace Sequence: GGAGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGACGTGAAGTTGCAGTTCCCTTCTCTGCCCCTGTGCAAGGAAGAAGCTGAGGACTGGGCCTATCCAATGAGAAGGGAAATGCAGGAAATTTTACCTGGCTTATTTTTGGGTCCATATTCAGCAGCAATGAAAAGCAAGCTCTCCGTATTTCAGAAATGTGGCATAACCCATGTCATCTGCATCAGACAAAACATTGAAGCTAATTTTATTAAACCAAACTTTCAGCAGTTATTTCGGTACTTAGTTCTGGACATTGCCGATAATCCAGTTGAAAACATAATTCGCTTTTTCCCAATGTCCAAGGAATTTATTGATGGATGTTTACAAACTGGAGGAAAGGTCCTTATCCACGGCAATGCAGGGATCTCTAGAAGTGCCGCCTTAGTAATTGCTTATATAATGGAAACCTTTGGAATAAAATACAGGGATGCCTTTACATATGTCCAGGAAAGAAGATTCTGTATCAATCCCAATGCTGGATTTGTTCACCAGCTTCAGGAATATGAAGCCATCTATCTAGCAGAGTTAACCATCAAAATGATGTCCCCTCTGCAGCTGGGAAGGCCGTTGTGTATACAGTCTGGTGCTACTGGAAGTCTCAAAAGGACACTTGATGATGAAGATGAACTTGGAAACATGCAAGTGTCTGCAGCCCATGAAGGATTGCCAACTTTCTTGTACAAAGTGGGCATTATAAGAAAGCATTGCCTAACCATTTTGTTGCAACCAACAGGTCACTAATCAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGACGTGAAGTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838352
dbEST ID: 79656054
Trimmed Sequence: TCCTTCATGGGCTGCAGACACCTGCATGTTTCCAAGTTCATCTTCATCATCAAGTGTCCTTTTGAGACTTCCAGTAGCACCAGACTGTATACACAACGGCCTTCCCAGCTGCAGAGGGGACATCATTTTGATGGTTAACTTTGCTAGATAGATGGCTTCATATTCCTGAAGCTGGTGAACAAATCCAGCATTGGGATTGATACAGAATCTTCTTTCCTGGACATATGTAAAGGCATCCCTGTATTTTATTCCAAAGGTTTCCATTATATAAGCAATTACTAAGGCGGCACTTCTAGAGATCCCTGCATTGCCGTGGATAAGGACCTTTCCTCCAGTTTGTAAACATCCATCAATAAATTCCTTGGACATTGGGAAAAAGCGAATTATGTTTTCAACTGGATTATCGGCAATGTCCAGAACTAAGTACCGAAATAACTGCTGAAAGTTTGGTTTAATAAAATTAGCTTCAATGTTTTGTCTGAAGCAGATGACATGGGTTATGCCACATTTCTGAAATACGGAGAGCTTGCTTTTCATTGCTGCTGAATATGGACCCAAAAAAAAGCCAGGTAAAATTTCCTGCTTTTCCGTTCCCCTTGGGAAAGGCCAAGTCTGTAACTTCTTTCTTGCACAAGGGGCAAAAAAGGGGAGGTGCAACTACACGTCCACCGTGGGGGCCAACTTTTTTGGGTCAAAAATTTGGCATTAAAAAAAAAAAAAATTA
Full Trace Sequence: CGCGAATCTGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCTTCATGGGCTGCAGACACCTGCATGTTTCCAAGTTCATCTTCATCATCAAGTGTCCTTTTGAGACTTCCAGTAGCACCAGACTGTATACACAACGGCCTTCCCAGCTGCAGAGGGGACATCATTTTGATGGTTAACTTTGCTAGATAGATGGCTTCATATTCCTGAAGCTGGTGAACAAATCCAGCATTGGGATTGATACAGAATCTTCTTTCCTGGACATATGTAAAGGCATCCCTGTATTTTATTCCAAAGGTTTCCATTATATAAGCAATTACTAAGGCGGCACTTCTAGAGATCCCTGCATTGCCGTGGATAAGGACCTTTCCTCCAGTTTGTAAACATCCATCAATAAATTCCTTGGACATTGGGAAAAAGCGAATTATGTTTTCAACTGGATTATCGGCAATGTCCAGAACTAAGTACCGAAATAACTGCTGAAAGTTTGGTTTAATAAAATTAGCTTCAATGTTTTGTCTGAAGCAGATGACATGGGTTATGCCACATTTCTGAAATACGGAGAGCTTGCTTTTCATTGCTGCTGAATATGGACCCAAAAAAAAGCCAGGTAAAATTTCCTGCTTTTCCGTTCCCCTTGGGAAAGGCCAAGTCTGTAACTTCTTTCTTGCACAAGGGGCAAAAAAGGGGAGGTGCAACTACACGTCCACCGTGGGGGCCAACTTTTTTGGGTCAAAAATTTGGCATTAAAAAAAAAAAAAATTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCTTCATGGGCTGCAGAC