ORFeome > suclg1 ORF1 – XORFeome v1.0

suclg1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: suclg1
Gene ID: 865154
Gene Page ID: 478219
ORF Xenbase ID: 17299413

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC082922
Original XGC clone length: 588

Human orthology & disease relationships

NCBI Entrez ID: 8802
Ensembl gene IDs: ENSG00000163541
Directly associated (OMIM) disease MIM numbers: 245400
Indirectly associated (Lage, et al.) disease MIM numbers: 115310,150800,171300,231670,248600,251000,252011,256000,312170,605373,605839,606812

Library Location

Plate ID: GDExl11004
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ839916
dbEST ID: 79657618
Trimmed Sequence: ATGGTGCAGGTCAAACACAGGCTTCTTCGCCAGACTACAACACGGTTAATTGGTCCCAACTGTCCTGGAGTCATTAATCCTGGTGAATGTAAAATTGGAATCATGCCTGGGCACATTCACAAAAAAGGAAGGATTGGGATCGTGTCCAGATCGGGCACCCTGACCTATGAAGCCGTGCATCAGACCACGCAGGTTGGATTGGGACAGTCGCTGTGCGTCGGTATTGGTGGTGACCCCTTCAATGGAACGAATTTCATTGATTGCCTTGATGTCTTCTTGAGTGATCCTAAAACCGAAGGCATTATACTGATTGGAGAGATTGGTGGCAGTGGCGAAGAAAATGCAGCTGAATTCCTAAGAGTAAACAATTCTGGTCCTAATGCCAAACCTGTAGTGTCCTTTATCGCTGGTCTAACGGCTCCCCCCGGCAGGAGAATGGGTCACGCTGGGGCCATTATTGCTGGAGGAAAAGGAGGCGCCAAGGAGAAAATTGCTGCTTTGCAGAAAGCTGGCGTCGTTGTTAGTATTTCCCCTGCCCAACTGGGCAGCACCATGCACAAGGGAGTTTGAAAAGAGAAAGAATCCTGTTGCCAACTTTCCTTGTACAAATTTGGCTTTATTAAAAAACATTTGCTTATTCATTTTTTTGCAACCAAACAGGTCACTAATCAATTCAAAAAAAAAACATTTATTTTCCCATCACAACCTAATTATCCCCCTAAAATTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: GGGGGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGCAGGTCAAACACAGGCTTCTTCGCCAGACTACAACACGGTTAATTGGTCCCAACTGTCCTGGAGTCATTAATCCTGGTGAATGTAAAATTGGAATCATGCCTGGGCACATTCACAAAAAAGGAAGGATTGGGATCGTGTCCAGATCGGGCACCCTGACCTATGAAGCCGTGCATCAGACCACGCAGGTTGGATTGGGACAGTCGCTGTGCGTCGGTATTGGTGGTGACCCCTTCAATGGAACGAATTTCATTGATTGCCTTGATGTCTTCTTGAGTGATCCTAAAACCGAAGGCATTATACTGATTGGAGAGATTGGTGGCAGTGGCGAAGAAAATGCAGCTGAATTCCTAAGAGTAAACAATTCTGGTCCTAATGCCAAACCTGTAGTGTCCTTTATCGCTGGTCTAACGGCTCCCCCCGGCAGGAGAATGGGTCACGCTGGGGCCATTATTGCTGGAGGAAAAGGAGGCGCCAAGGAGAAAATTGCTGCTTTGCAGAAAGCTGGCGTCGTTGTTAGTATTTCCCCTGCCCAACTGGGCAGCACCATGCACAAGGGAGTTTGAAAAGAGAAAGAATCCTGTTGCCAACTTTCCTTGTACAAATTTGGCTTTATTAAAAAACATTTGCTTATTCATTTTTTTGCAACCAAACAGGTCACTAATCAATTCAAAAAAAAAACATTTATTTTCCCATCACAACCTAATTATCCCCCTAAAATTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCAGGTCAAACACAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839915
dbEST ID: 79657617
Trimmed Sequence: CAGCATCTTTCTCTTTTCAAACTCCTTGTGCATGGTGCTGCCCAGCTGGGCAGGGGACATACTAACAACGACGCCAGCTTTCTGCAAAGCAGCAATTTTCTCCTTGGCGCCTCCTTTTCCTCCAGCAATAATGGCCCCCGCGTGACCCATTCTCCTGCCGGGGGGAGCCGTTAGACCAGCGATAAACGACACTACAGGTTTGGCATTAGGACCAGAATTGTTTACTCTTAGGAATTCAGCTGCATTTTCTTCGCCACTGCCACCAATCTCTCCAATCAGTATAATGCCTTCGGTTTTAGGATCACTCAAGAAGACATCAAGGCAATCAATGAAATTCGTTCCATTGAAGGGGTCACCACCAATACCGACGCACAGCGACTGTCCCAATCCAACCTGCGTGGTCTGATGCACGGCTTCATAGGTCAGGGTGCCCGATCTGGACACGATCCCAATCCTTCCTTTTTTGTGAATGTGCCCAGGCATGATTCCNATTTTACATTCACCAGGATTAATGACTCCNGGACAGTTGGGACCAATTAACCGTGTTGTAGTCTGGCGAAGAAGCCTGTGTTTGACCTGCACCATGG
Full Trace Sequence: GACGAGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGCATCTTTCTCTTTTCAAACTCCTTGTGCATGGTGCTGCCCAGCTGGGCAGGGGACATACTAACAACGACGCCAGCTTTCTGCAAAGCAGCAATTTTCTCCTTGGCGCCTCCTTTTCCTCCAGCAATAATGGCCCCCGCGTGACCCATTCTCCTGCCGGGGGGAGCCGTTAGACCAGCGATAAACGACACTACAGGTTTGGCATTAGGACCAGAATTGTTTACTCTTAGGAATTCAGCTGCATTTTCTTCGCCACTGCCACCAATCTCTCCAATCAGTATAATGCCTTCGGTTTTAGGATCACTCAAGAAGACATCAAGGCAATCAATGAAATTCGTTCCATTGAAGGGGTCACCACCAATACCGACGCACAGCGACTGTCCCAATCCAACCTGCGTGGTCTGATGCACGGCTTCATAGGTCAGGGTGCCCGATCTGGACACGATCCCAATCCTTCCTTTTTTGTGAATGTGCCCAGGCATGATTCCNATTTTACATTCACCAGGATTAATGACTCCNGGACAGTTGGGACCAATTAACCGTGTTGTAGTCTGGCGAAGAAGCCTGTGTTTGACCTGCACCATGGTGCCCACTTTTTTGTACAAAGTTGGCATTATAAAAAACATTGCTCATCATTTTGTTGCACCAAAAGGGTCACTTATCAGTCAAAAAAAAAACATTAATTGGGGGCCCGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGCATCTTTCTCTTTTCAAACTC