ORFeome > sult1c1 ORF1 – XORFeome v1.0

sult1c1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sult1c1
Gene ID: 6254225
Gene Page ID: 6460750
ORF Xenbase ID: 17299461

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043790
Original XGC clone length: 915

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ823989
dbEST ID: 79641691
Trimmed Sequence: ATGAATCCAGCAGCGATGGAAGAACTGACAAAGGGAATGGAGAATTTCCAGGTTACCATGGGCCATATTGAGGGGGTCCCACTGCCAGTCACTACCTGTGACATGTGGGACACTATATACAATTTCCAGGCCAGGAAGGACGACATCCTCATTGCTACCTACCCCAAAGCAGGGACAACGTGGATGCAGGAGATCGTGGATCTGATATTACAAGAGGGAGATGTTCAGAAGAGCATGAGGGCCCCGTGTTATATCAAAGTGCCCTTCATAGACCTGGTACCACCAAAGCCCATGCCACCAGGTGTGGCGTTGGCGCAAACCATGAACTCTCCTCGTATCCTAAAAACTCACTTACCAATTAACCTGCTGCCCCCATCTTTTTGGGAGAAAAATACCAAGGTTGTCTATGTTGCCAGAAATGCCAAGGACTCTATGGTTTCTTATTATTACTTTCATAAGATGAATAAATTTTTGCCGGACTCTGGAACCTTGGATAACTTCTTCTCAGAATTCCTGTCTGGAGATGTGCCATGGGGGGAGTTGGTTTGACAACGTACTTGGATGGTGGAAAGCTTTAGACAAACATCAGATACTTTTTATCTTCTATGAGGACATGATTCAGGACCCAATGCGTGAGATTAAGAAGGTCATGACGTTCCTGGGTAAGGACTTATCTGATGAAGTTCTGGAGAAGATCANGTATCACACTTCCNTCCANGCAATGAAAAGAGAACCCTATGACAAAATAACAGCACCGTTCCCAAAAACTATCATGGGACCAAAACCATATCTTCCTTTTTATAAAAAAAAG
Full Trace Sequence: TAATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATCCAGCAGCGATGGAAGAACTGACAAAGGGAATGGAGAATTTCCAGGTTACCATGGGCCATATTGAGGGGGTCCCACTGCCAGTCACTACCTGTGACATGTGGGACACTATATACAATTTCCAGGCCAGGAAGGACGACATCCTCATTGCTACCTACCCCAAAGCAGGGACAACGTGGATGCAGGAGATCGTGGATCTGATATTACAAGAGGGAGATGTTCAGAAGAGCATGAGGGCCCCGTGTTATATCAAAGTGCCCTTCATAGACCTGGTACCACCAAAGCCCATGCCACCAGGTGTGGCGTTGGCGCAAACCATGAACTCTCCTCGTATCCTAAAAACTCACTTACCAATTAACCTGCTGCCCCCATCTTTTTGGGAGAAAAATACCAAGGTTGTCTATGTTGCCAGAAATGCCAAGGACTCTATGGTTTCTTATTATTACTTTCATAAGATGAATAAATTTTTGCCGGACTCTGGAACCTTGGATAACTTCTTCTCAGAATTCCTGTCTGGAGATGTGCCATGGGGGGAGTTGGTTTGACAACGTACTTGGATGGTGGAAAGCTTTAGACAAACATCAGATACTTTTTATCTTCTATGAGGACATGATTCAGGACCCAATGCGTGAGATTAAGAAGGTCATGACGTTCCTGGGTAAGGACTTATCTGATGAAGTTCTGGAGAAGATCANGTATCACACTTCCNTCCANGCAATGAAAAGAGAACCCTATGACAAAATAACAGCACCGTTCCCAAAAACTATCATGGGACCAAAACCATATCTTCCTTTTTATAAAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATCCAGCAGCGATGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829297
dbEST ID: 79646999
Trimmed Sequence: GAGTTCAGTGCGGAAGTTTAACCCACTGCCTTCCATCTTCTTCTTGTATTCCTCATCAAAGATAATGTTCTGTGCCACCGAGAAATGGGTTTTCCAATCCCCCACAGTCCCTTTTCTTATAAAAGGAGATATGGTTTGGTCCATGATAGTTTTGGGAACGGTGCTGTTATTTGTCATAGGGTTCTCCTTCATTGCCTGGAAGGAAGTGTGATACTTGATCTTCTCCAGAACTTCATCAGATAAGTCCTTACCCAGGAACGTCATGACCTTCTTAATCTCACGCATTGGGTCCTGAATCATGTCCTCATAGAAGATAAAAAGTATCTGATGTTTGTCTAAAGCTTTCCACCATCCAAGTACGTTGTCAAACCAACTCCCCCATGGCACATCTCCAGACAGGAATTCTGAGAAGAAGTTATCCAAGGTTCCAGAGTCCGGCAAAAATTTATTCATCTTATGAAAGTAATAATAAGAAACCATAGAGTCCTTGGCATTTCTGGCAACATAGACAACCTTGGTATTTTTCTCCCAAAAAGATGGGGGCAGCAGGTTAATTGGTAAGTGAGTTTTTAGGATACGAGGAGAGTTCATGGTTTGCGCCAACGCCACACCTGGGTGGCATGGGGCTTTGGTGGTACCAGGTCTAATAAGGGGCACTTTTGATATAACAAGGGGGCCCTCAGGGCTCTTCCTGAACCATCTCCCTTCTTGTAATTATCCAAAATCCACGAATTTTCCCGCCACCCCACCTTTGTCCCTTGGCTTTTGGGGGGTAGG
Full Trace Sequence: CCGCGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGTTCAGTGCGGAAGTTTAACCCACTGCCTTCCATCTTCTTCTTGTATTCCTCATCAAAGATAATGTTCTGTGCCACCGAGAAATGGGTTTTCCAATCCCCCACAGTCCCTTTTCTTATAAAAGGAGATATGGTTTGGTCCATGATAGTTTTGGGAACGGTGCTGTTATTTGTCATAGGGTTCTCCTTCATTGCCTGGAAGGAAGTGTGATACTTGATCTTCTCCAGAACTTCATCAGATAAGTCCTTACCCAGGAACGTCATGACCTTCTTAATCTCACGCATTGGGTCCTGAATCATGTCCTCATAGAAGATAAAAAGTATCTGATGTTTGTCTAAAGCTTTCCACCATCCAAGTACGTTGTCAAACCAACTCCCCCATGGCACATCTCCAGACAGGAATTCTGAGAAGAAGTTATCCAAGGTTCCAGAGTCCGGCAAAAATTTATTCATCTTATGAAAGTAATAATAAGAAACCATAGAGTCCTTGGCATTTCTGGCAACATAGACAACCTTGGTATTTTTCTCCCAAAAAGATGGGGGCAGCAGGTTAATTGGTAAGTGAGTTTTTAGGATACGAGGAGAGTTCATGGTTTGCGCCAACGCCACACCTGGGTGGCATGGGGCTTTGGTGGTACCAGGTCTAATAAGGGGCACTTTTGATATAACAAGGGGGCCCTCAGGGCTCTTCCTGAACCATCTCCCTTCTTGTAATTATCCAAAATCCACGAATTTTCCCGCCACCCCACCTTTGTCCCTTGGCTTTTGGGGGGTAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGTTCAGTGCGGAAGTT