ORFeome > sult1c4 ORF1 – XORFeome v1.0

sult1c4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sult1c4
Gene ID: 6048110
Gene Page ID: 6048085
ORF Xenbase ID: 17299479

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC153769
Original XGC clone length: 915

Human orthology & disease relationships

NCBI Entrez ID: 27233
Ensembl gene IDs: ENSG00000198075
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 217800,259900,606664

Library Location

Plate ID: GDExl11092
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ839042
dbEST ID: 79656744
Trimmed Sequence: ATGGATCCAGCAGCGATGGAAGAACTGGTGAAGGTAATGGAGAATATGCAGTTTACTATGGGCCACATTGAGGGGGTATCACTGCCAGGCTTCACCTGTGATGCGTGGGACACAATATATAATTTCCAGGCCCGGGAGGACGACATCCTCATCTCTACCTACCCCAAAGCAGGGACAACGTGGATGCACGAGATCATGGATCTGATATTACAAGAGGGAGACATACAGAAGAGCATGAGGGCCCCGTGTTACGTCAAAGTGCCCTTCATAGAGATGGTAACACCAAAGCCCATGCCATCAGGTGTGGAGTTGGCAGAAAAGATGGCATCTCCTCGTATCATAAAAACTCACTTACCAATTAGTCTGCTTCCACCCTCCTTTTTGGAGAAAAATGTCAAGGTTGTCTATGTTGCCAGAAATGCCAAGGACTGTATGGTTTCTTATTATTACTTCCAGAAGATGAACAAGGGTCTGCCGGACCCCGGAACCTGGGAGAATTACTTCTCAACTTTCCTGTCTGGAGATGTGCCCTGGGGCAGTTGGTTTGACCATGTACTTGGCTGGTGGAAAGCTGTTGACAAACACCAGATACTCTTTGTTTTCTATGAGGACATGATCAAGGACCCAATGTGCGAGATTCGGAAAGTCATGAAGTTCCTCGGGGAAGGATTTATCTGATGAAGTTTTTGAGAACATTAAGTATCACACTTCTTTCCAGGCCATGAAGGGAGACCCCTATGGCAAATTACCCAAACTACCCCAAGGGCTAACCTTTGAACAAACCAATATCTCCCTTTCAGAAAAAAAAAGGGG
Full Trace Sequence: TTCGGGGACCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCCAGCAGCGATGGAAGAACTGGTGAAGGTAATGGAGAATATGCAGTTTACTATGGGCCACATTGAGGGGGTATCACTGCCAGGCTTCACCTGTGATGCGTGGGACACAATATATAATTTCCAGGCCCGGGAGGACGACATCCTCATCTCTACCTACCCCAAAGCAGGGACAACGTGGATGCACGAGATCATGGATCTGATATTACAAGAGGGAGACATACAGAAGAGCATGAGGGCCCCGTGTTACGTCAAAGTGCCCTTCATAGAGATGGTAACACCAAAGCCCATGCCATCAGGTGTGGAGTTGGCAGAAAAGATGGCATCTCCTCGTATCATAAAAACTCACTTACCAATTAGTCTGCTTCCACCCTCCTTTTTGGAGAAAAATGTCAAGGTTGTCTATGTTGCCAGAAATGCCAAGGACTGTATGGTTTCTTATTATTACTTCCAGAAGATGAACAAGGGTCTGCCGGACCCCGGAACCTGGGAGAATTACTTCTCAACTTTCCTGTCTGGAGATGTGCCCTGGGGCAGTTGGTTTGACCATGTACTTGGCTGGTGGAAAGCTGTTGACAAACACCAGATACTCTTTGTTTTCTATGAGGACATGATCAAGGACCCAATGTGCGAGATTCGGAAAGTCATGAAGTTCCTCGGGGAAGGATTTATCTGATGAAGTTTTTGAGAACATTAAGTATCACACTTCTTTCCAGGCCATGAAGGGAGACCCCTATGGCAAATTACCCAAACTACCCCAAGGGCTAACCTTTGAACAAACCAATATCTCCCTTTCAGAAAAAAAAAGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCCAGCAGCGATGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839041
dbEST ID: 79656743
Trimmed Sequence: AAATTCAGTGCGGAAGTTTAGCCCACTGCCCTCCATTGTCTTCTTGTATTTCTCATCAAAGATAATGTTCTGTGCCACTGTGAAATGGGTTTTCCAATCCCCCACAATCCCTTTTCTCATGAAAGGAGATATGGTTTGGTCAAAGATAGCCTTGGGTAGTGTGGTGTAATTTGCCATAGGGTTCTCCTTCATGGCCTGGAAAGAAGTGTGATACTTAATGTTCTCCAAAACCTCATCAGATAAATCCTTCCCGAGGAACTTCATGACTTTCCGAATCTCGCACATTGGGTCCTTGATCATGTCCTCATAGAAAACAAAGAGTATCTGGTGTTTGTCAACAGCTTTCCACCAGCCAAGTACATGGTCAAACCAACTGCCCCAGGGCACATCTCCNGACAGGAAAGTTGAGAAGTAATTCTCCCAGGTTCCGGGGTCCGGCAGACCCTTGTTCATCTTCTGGAAGTAATAATAAGAAACCATACAGTCCTTGGCATTTCTGGCAACATAAAACACCTTGACATTTTTCTCCAAAAAGAGGGTGAAGCAGACTAATTTGTAAATGAGTTTTTATGATACGAGGAGATGCCAACTTTTTCTCCCACTCCACACCTAAAGGCATGGGCGTTTGGGGTTACCATCTCTAAAAAGGGCCACTTTGACGTACCACCGGGGCCCCTCCTGGCCCCTCCGGTGGTTCTTCCCTTCCTTGAAAAATCCAAAACCCAGGAAATCTGCCGGGCATCCCCCCTTTTGTTTCCCC
Full Trace Sequence: GGGGAAACGTCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAATTCAGTGCGGAAGTTTAGCCCACTGCCCTCCATTGTCTTCTTGTATTTCTCATCAAAGATAATGTTCTGTGCCACTGTGAAATGGGTTTTCCAATCCCCCACAATCCCTTTTCTCATGAAAGGAGATATGGTTTGGTCAAAGATAGCCTTGGGTAGTGTGGTGTAATTTGCCATAGGGTTCTCCTTCATGGCCTGGAAAGAAGTGTGATACTTAATGTTCTCCAAAACCTCATCAGATAAATCCTTCCCGAGGAACTTCATGACTTTCCGAATCTCGCACATTGGGTCCTTGATCATGTCCTCATAGAAAACAAAGAGTATCTGGTGTTTGTCAACAGCTTTCCACCAGCCAAGTACATGGTCAAACCAACTGCCCCAGGGCACATCTCCNGACAGGAAAGTTGAGAAGTAATTCTCCCAGGTTCCGGGGTCCGGCAGACCCTTGTTCATCTTCTGGAAGTAATAATAAGAAACCATACAGTCCTTGGCATTTCTGGCAACATAAAACACCTTGACATTTTTCTCCAAAAAGAGGGTGAAGCAGACTAATTTGTAAATGAGTTTTTATGATACGAGGAGATGCCAACTTTTTCTCCCACTCCACACCTAAAGGCATGGGCGTTTGGGGTTACCATCTCTAAAAAGGGCCACTTTGACGTACCACCGGGGCCCCTCCTGGCCCCTCCGGTGGTTCTTCCCTTCCTTGAAAAATCCAAAACCCAGGAAATCTGCCGGGCATCCCCCCTTTTGTTTCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGTTCAGTGCGGAAGTTTAG