ORFeome > sumo3 ORF1 – XORFeome v1.0

sumo3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: sumo3
Gene ID: 1004218
Gene Page ID: 1004210
ORF Xenbase ID: 17299539

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054172
Original XGC clone length: 285

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ839090
dbEST ID: 79656792
Trimmed Sequence: ATGTCTGAAGAGAAACCCAAGGAAGGTGTGAAGACAGAGAATGACCACATCAACCTGAAAGTGGCAGGGCAGGATGGATCTGTGGTTCAGTTCAAAATAAAAAGGCACACACCACTCAGCAAGTTAATGAAAGCTTACTGCGACAGACAGGGCCTATCAATGCGACAGATAAGGTTCAGGTTTGATGGACAACCTATCAATGAAACAGACACACCTGCACAGCTGGAGATGGAAGATGAAGATACCATTGATGTGTTCCAACAACAGACAGGTGGTGTTTGCTT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGAAGAGAAACCCAAGGAAGGTGTGAAGACAGAGAATGACCACATCAACCTGAAAGTGGCAGGGCAGGATGGATCTGTGGTTCAGTTCAAAATAAAAAGGCACACACCACTCAGCAAGTTAATGAAAGCTTACTGCGACAGACAGGGCCTATCAATGCGACAGATAAGGTTCAGGTTTGATGGACAACCTATCAATGAAACAGACACACCTGCACAGCTGGAGATGGAAGATGAAGATACCATTGATGTGTTCCAACAACAGACAGGTGGTGTTTGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGACCGAATCACAAAATATCAAATGTTACACCTCATCTTGGACCGGCAGGAAGAAAGAAAAAAAAAGGATGAACCCAAAGTTGGGCCGGTTCATTTACGGGTGGATTGGAGAAGAGGCCTACCCGAAGGAAACAAACCCGCCGGGGGCGGAATTGGAACGGGAGGAGCGAAGCGCCGGAAGGGGCGGGGCCAAACCCTTGACCAAAACACGCGGGGGGGGGGGGAAAGGGGGGTTTTTGGGTTGTGTTTTAAGGGTTTTTTTGTGGGAAATGGTGGCCCCAAAACACCTCAAAGCCAAAAAACGCCACGGGGGGGGGGGAGAGGTGTGGTTGTGGGTGGGGGTTTTCTATAGTGGGTCGGGTGATTAAAATAAAACCTCCTTTATTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGAAGAGAAACCCAAGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839089
dbEST ID: 79656791
Trimmed Sequence: GCAAACACCACCTGTCTGTTGTTGGAACACATCAATGGTATCTTCATCTTCCATCTCCAGCTGTGCAGGTGTGTCTGTTTCATTGATAGGTTGTCCATCAAACCTGAACCTTATCTGTCGCATTGATAGGCCCTGTCTGTCGCAGTAAGCTTTCATTAACTTGCTGAGTGGTGTGTGCCTTTTTATTTTGAACTGAACCACAGATCCATCCTGCCCTGCCACTTTCAGGTTGATGTGGTCATTCTCTGTCTTCACACCTTCCTTGGGTTTCTCTTCATACATGCTG
Full Trace Sequence: CGAGAATATGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCNNCAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAAACACCACCTGTCTGTTGTTGGAACACATCAATGGTATCTTCATCTTCCATCTCCAGCTGTGCAGGTGTGTCTGTTTCATTGATAGGTTGTCCATCAAACCTGAACCTTATCTGTCGCATTGATAGGCCCTGTCTGTCGCAGTAAGCTTTCATTAACTTGCTGAGTGGTGTGTGCCTTTTTATTTTGAACTGAACCACAGATCCATCCTGCCCTGCCACTTTCAGGTTGATGTGGTCATTCTCTGTCTTCACACCTTCCTTGGGTTTCTCTTCATACATGCTGCCAATTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGCAAATCAAATTTAAATAGTTTGACCTAGGTGTTTTCCTGGCAGCTCAAAACAAAAATAACAAAATATCAGATCATCAAANAGGGGGGGGTAGGCTCACACCGTAATTAGAAGTAAAAACACCCCCNAAGAAAAAAATCGCGGTCCGTTTCTTTTTAGAATTTGGTATTCAAGGGCCACCCCCCCGGGGTCCAAAACCAAANNACGGCCCCGAAGGGGGTTAGATGGGTGGGGTGGATTCAGGGCGCGACAAAGGGGTTTANAGNNANNNGATNNAACACCCNAGGNGNGAANNAAGNNNNGNNNCCNNCAAGTTTTGTNTAGGGATTTATATATANANNAANNTTNNGAGNGGGGGAGANNNAATNACCNNGCGAANNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAAACACCACCTGTCTG