ORFeome > supt5h ORF1 – XORFeome v1.0

supt5h ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: supt5h
Gene ID: 1013286
Gene Page ID: 1013281
ORF Xenbase ID: 17299569

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129066
Original XGC clone length: 3252

Human orthology & disease relationships

NCBI Entrez ID: 6829
Ensembl gene IDs: ENSG00000196235
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 214150,216400,601675

Library Location

Plate ID: GDExl11085
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ837761
dbEST ID: 79655463
Trimmed Sequence: ATGTCAGACAGCGAAGACAGCAACTTTTCTGAAGAGGAGAGTGATAGGAGCAGCGAGGCTGAAGAGGTAGAGGAAAATGAGGAGGTGGAGGAGGAGAGAGCCAGCCCTGCGGCCGGTGAGAGAGGGGAAGTTGGAGTCCATGACGACGATGGTGTCGTACGTTGGGATTATGAAAAAGAATTGATTATCCATTTGTTGCAACGAACAGGTCACTATCAGTCACAATAAAATCATTATTTGCCATCTCTGGTATATATCCCATATCGTGAGTTATATTATTTGGTCATAGAACTGGTCCCGGCTACGCTGGCCCGTGTCAGAATGCCCACAAGAAAATAATTGACCATGCTAGACAGTGTCGGGATGAAAAAATGGAAAGGAGCTCGGACTAAAATGAGTCGACTGGTTGACGCAGCTGTGGTTGCCGAGGAGCAACCAGACCACGGAGAAAATAAGCATGGTTCGGATCCGAAGTGTACATACACACTGGCGAAGAGGGTAAGAAAAAAGGGTCAAGAACCTTGGTCCGACCCAAGGCGGGGGGAACGGGCACACTTGGGGCTTAACTCGGCCCGGTGGTTAACGGTTCTAAGGGGGGGGGTTTTCCTGGGCGTCGGGTTGGCGGGGTGTAATTGGGGGGGCCCGCACGGGTGCTTGGTGGAGAATTCAGGGGAGAAGAAGCCGANTTTTCGCGGGGGGGGGGTGGCTGTGGGGTGTGAGNNTTTGTGATAGACTTTGTGGGGGGAGGGGTGGGGAGNANGGGAGGGGTAACCGACCCCCCGATAANNACGGGAG
Full Trace Sequence: GCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGACAGCGAAGACAGCAACTTTTCTGAAGAGGAGAGTGATAGGAGCAGCGAGGCTGAAGAGGTAGAGGAAAATGAGGAGGTGGAGGAGGAGAGAGCCAGCCCTGCGGCCGGTGAGAGAGGGGAAGTTGGAGTCCATGACGACGATGGTGTCGTACGTTGGGATTATGAAAAAGAATTGATTATCCATTTGTTGCAACGAACAGGTCACTATCAGTCACAATAAAATCATTATTTGCCATCTCTGGTATATATCCCATATCGTGAGTTATATTATTTGGTCATAGAACTGGTCCCGGCTACGCTGGCCCGTGTCAGAATGCCCACAAGAAAATAATTGACCATGCTAGACAGTGTCGGGATGAAAAAATGGAAAGGAGCTCGGACTAAAATGAGTCGACTGGTTGACGCAGCTGTGGTTGCCGAGGAGCAACCAGACCACGGAGAAAATAAGCATGGTTCGGATCCGAAGTGTACATACACACTGGCGAAGAGGGTAAGAAAAAAGGGTCAAGAACCTTGGTCCGACCCAAGGCGGGGGGAACGGGCACACTTGGGGCTTAACTCGGCCCGGTGGTTAACGGTTCTAAGGGGGGGGGTTTTCCTGGGCGTCGGGTTGGCGGGGTGTAATTGGGGGGGCCCGCACGGGTGCTTGGTGGAGAATTCAGGGGAGAAGAAGCCGANTTTTCGCGGGGGGGGGGTGGCTGTGGGGTGTGAGNNTTTGTGATAGACTTTGTGGGGGGAGGGGTGGGGAGNANGGGAGGGGTAACCGACCCCCCGATAANNACGGGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGACAGCGAAGACAGCAA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGCAGGGAACAGCCACGGAACAAGCGAAAACGAACCACACAAGGGGGAGAAAGCCGGGAGGGCAAAAAACGATATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGACTCCAACTTCCCCTTTCTCACTGGCCTCAGGGCCGGCTCTCTCCCCCCCCGACTCCTTCTTATCATCTCCCCCTCCTTCCCCACTGCTCCTATGACTCTCGTCTCCTCAAAATTTGCTGTCTTCACTGTCTGACATGGGGCCTACTTTTTTGTACTAACTTGGCATTATAAAAAACCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCACTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGGCCGTCGTTTAACAACATCATGACAGGGTAAAATCCAGATTGCTCACGACAACGCGAAAGTAAAGAAAACAGCTAGCTCCGAACACAGGGAGCGGGGTAGCCGCAAGAGGGGACCTAACGTTACAACTGGGGCAGGGGAGGAGAACGCTATCGTATTGGACCGTCTCGGCCGTGAGCGAGATGCGACGAAAAAAACCAAAACCTGGGCGGTCGCTGCGTGGGTACGGGGAAGGGGGGGTTGGAGGGAGGGAACGACGGGGGTCTGGGAGGCAAAGTGGGGGGGGGCGGGCAACGAGAGAAGGGTCCGCGAGGGTGCGGTGGAGGAGGGGAGACCGCGGGGAGGAAGGGGGGGGGTGTGGGGCCNGGGGAGGTGNGGGGTGGGGGGGGAAGGAAGGGGANNGGAGGAGCGGGGGGGGGGGGGGAGGGGNGGGGGGGGGAGGNNNAGNNTGGGGGGNGGAGGNNNANGNNGGNGGGGGNGGGGGGNGNNNGAAGGGANAAGGGGGGAGAGANGGAGNNGGGNGAAANGNGGAGGANNNAGGGNGAAGAGAANGGAGGGGGGNNNGGNNAGGGGGGGGGGGGGGAGGGAGNGGAGGGGGNGGGGGAGGGAGAGGGGAGGAGAGNGGGNNNNANNGAGANNAGAAAAAGAAGAANAAAAGAANAGGANGNGANNNNNGNNNNGGAANCGAGGGGANGNGGGGNGGGNNGNNGGGAGGGGGGGGGGGGGAGAGGAGGGGGAGNGGNNGGGGGGGAGTGTGGGGAGNGCGNGNGGAGAANGAGAGAAAGAAGAAANGANAGGGGGAGAGGNNGGGAGGAGGGNGGNGAAGAGGANGNNNNGGGGNNGAGGGGNTGGAANCAGGGNNGGAGGNNGAAGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGACTCCAACTTCCCCA