ORFeome > suv420h2 ORF1 – XORFeome v1.0

suv420h2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: suv420h2
Gene ID: 6252183
Gene Page ID: 6459062
ORF Xenbase ID: 17299623

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126060
Original XGC clone length: 2286

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ837784
dbEST ID: 79655486
Trimmed Sequence: ATGGGTTCAAATCGGTTGACGGAAGGTGCGACGAAAAATGTGGCATTTAACCCATTCACTCCCTCAAAAAGACTGCGGCTCGTGGTCAGCCATGGTTCTATCGCTCTAGACATGGCATCCACGTCGAGTGAAGAAACCAGTTT
Full Trace Sequence: AGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTTCAAATCGGTTGACGGAAGGTGCGACGAAAAATGTGGCATTTAACCCATTCACTCCCTCAAAAAGACTGCGGCTCGTGGTCAGCCATGGTTCTATCGCTCTAGACATGGCATCCACGTCGAGTGAAGAAACCAGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCTTATTACATGGTCATAACTGTTTCCTGGCAGCTCTGGCCCGTGTCAAAAAAAATCAAACAATATATATTCAAGCATCATGCAAATGACGCACCACGCAGAACACAAAAGCTCCCTGGAAACAAAGGCCTCGGGTGCGCTGGTCGTCTGGGTGGAAGGGGGACACACCCCGCGCAAAACGCATGATAGGGTCTACCAGCAGTAAAAATAAACCTGTTCAGGTCCGTCCTCCGGGTATGAAACTAGACGTATGCACCTAACGCAACCTGGGCCAGAGCCCTTGACCGATACCCATGGGTTGGTTATTGTTCGGATTTGGGGGGTTTTCCTGGGCTTCGGTAAGAACAGATTTTTTGGCCGGAACACGCCTGTGTTCTTGTTGGTTTCCCAAGCCCACCAAAAACTTTTTACCCCGGGGGGCCCCCCTTTTTCCCAAGATTAAAAAGAAAACCCAAGCCACGGGTGTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTTCAAATCGGTTGACGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837783
dbEST ID: 79655485
Trimmed Sequence: ACTGGTTTCTTCACTCGACGTGGATGCCATGTCTAGAGCGATAGAACCATGGCTGACCACGAGCCGCAGTCTTTTTGAGGGAGTGAATGGGTTAAATGCCACATTTTTCGTCGCACCTTCCGTCAACCGATTTGAACCCATGG
Full Trace Sequence: GCGCACGGGAAGAGCCACGGAAGAAGGAAAAAGGAGCAACAAGAGGGGGAGAGAGCCGGGGGGGAGAGAGAGAGAAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTGGTTTCTTCACTCGACGTGGATGCCATGTCTAGAGCGATAGAACCATGGCTGACCACGAGCCGCAGTCTTTTTGAGGGAGTGAATGGGTTAAATGCCACATTTTTCGTCGCACCTTCCGTCAACCGATTTGAACCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGGCCGTCGTTATAAAAACAAATGACAGAGATAAAAAATGCCTACGCAACTCGCTAAGCGCGAGAGAAGGGAAAAGTCCGGGGATACAATAGGATCGAATGGTGAAACAGACAGTAGGAGGGGGGTAAGAGGACAAGGGTGGAAACAAAGAGGAAGGGTCCTCTGGTGAGGAGGTAAGACGGGTCGGGGTGGGGGATGAGGCACTGGGGAAAACGAACATGCACGGAAGGCACCGGGGGTAAGAGGCTAGAGGGAGGGTTACGGGGTGGTAGTAGGCGAAGTTGTTTGTTGGTACAGGCTATGTACCAGGGGTCGGAGAGAGGAAACGGGTAACCCCTCGGGCGTCGGTTAAATGTTATCGGCTAACGGCAATGAGTCCACTGTCGGAAGGTGAGCGAAAAACCAAATTAAGTAAAAAGAGATGGAAAGGCGAGCGGCGAGCAATATCAACATCTATAAGAAGGGAAATGGTGTTCTGGGCGACATACCGCGCCACACAAATACGGAGGTGGGGGTGGGGTATGGGGCGCGGGGATGAAAGCCGGACGTTGAGAGGGGGGGAATATGTGTGTGTTATGGGCGGTTGTGGAGGGGAGCGGCGGGGGGAGAAAAGGANGGTAGTGAGTTGGTAGGGCGGCGCACTAATGGCAGAAAAAAGCTCCGGAGGAAGAGGAGGGAAAGGGGGTGTTGAGTGAAAGAAGAGTTGTAGGGGAGAGTAGGGAGGGGCACCNAGCAGAAGGGAGGGGCGCAGCGCACGCGNGGGAGGAGGGGGGAGGAGAGGAGAAAGAGAGAGGGGGGGAAGAAGAAAGCGATAATGGGGGAGTTGTCGCAGCGGCGGAGCAGCGAGCGACGACGCGGGAGGGAGGTGTGGGGTAGGTGGAGTGGAGAGGGAAGAGAGANGAGAGAGAGAAAAAAAGAGATAAGGAAACAGGGAGGGGGTTGTGGTGGAAGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGGTTTCTTCACTCGACGTGG