ORFeome > t ORF2 – XORFeome v1.0

t ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: t
Gene ID: 6255736
Gene Page ID: 478788
ORF Xenbase ID: 17299779

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC072224
Original XGC clone length: 1299

Human orthology & disease relationships

NCBI Entrez ID: 6862
Ensembl gene IDs: ENSG00000164458
Directly associated (OMIM) disease MIM numbers: 182940,615709
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11046
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ830790
dbEST ID: 79648492
Trimmed Sequence: ATGAGTGCGACCGAGAGCTGCGCCAAGAACGTGCAGTACCGGGTAGATCATCTGCTGAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAAAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGTCTGCAGGAGCGGGACCTGTGGACGAGGTTTAAGGAGCTCACCAATGAGATGATCGTCACTAAGAATGGAAGGAGAATGTTTCCAGTTCTGAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACGGTTCTTCTGGACTTTGTGGCAGCTGACAACCTCCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCTAGTTGTGTTTACATCCACCCAGATTCCCCCAATTTTGGAGCCCACTGGATGAAAGATCCTGTGTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATTGTGAGAGTTGGCGGCACCCAGAGAATGATCACCAGCCATTCATTCCCTGAGACACAGTTCATAGCAGTGACCGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAGCACAACCCATTTGCCAAAGCATTTCTTGATGGCAAAGAAAGAAATGATTATAAAGACTTCTTGGGATGAGGGAATTTAAAAGTCAGCACTTCAAATTTCTTCTCATTTAGGTACCTTGGGTCCATTTCCTAAAGGGTGGGGATCATTTATTGTACCCCCCCAAATTCCCCCACACCTTCAAGTT
Full Trace Sequence: GGTCTTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGCGACCGAGAGCTGCGCCAAGAACGTGCAGTACCGGGTAGATCATCTGCTGAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAAAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGTCTGCAGGAGCGGGACCTGTGGACGAGGTTTAAGGAGCTCACCAATGAGATGATCGTCACTAAGAATGGAAGGAGAATGTTTCCAGTTCTGAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACGGTTCTTCTGGACTTTGTGGCAGCTGACAACCTCCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCTAGTTGTGTTTACATCCACCCAGATTCCCCCAATTTTGGAGCCCACTGGATGAAAGATCCTGTGTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATTGTGAGAGTTGGCGGCACCCAGAGAATGATCACCAGCCATTCATTCCCTGAGACACAGTTCATAGCAGTGACCGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAGCACAACCCATTTGCCAAAGCATTTCTTGATGGCAAAGAAAGAAATGATTATAAAGACTTCTTGGGATGAGGGAATTTAAAAGTCAGCACTTCAAATTTCTTCTCATTTAGGTACCTTGGGTCCATTTCCTAAAGGGTGGGGATCATTTATTGTACCCCCCCAAATTCCCCCACACCTTCAAGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGCGACCGAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ830791
dbEST ID: 79648493
Trimmed Sequence: GATTGATGGTGGTGCAACTGGTGTCCATGCTGATGAAAGCCTGGAATGTGCAGTGACATCATACTGGTTTTCTGCTATTTCTGTTTGTGCTCCATGTTCATACAATGGGGATCCTGTGGTTGGTGAGGGCACAGCATGTGAAAGAGATGAGTAATGAGGTGTAGAGCCACGTAGGTACTGGGGACTTGTTCCATTACTTATTCCTCCAGACTGAGACACTGGTGTGATGGTACTGTTACTTACAGACCACAAAGAAGTGTACTGACTTGAGGTAGGTGGTGTTCCTGTGCTGTGACTCATTGGCAACATCCCTGTGTGTGCTGGCATTTGAAGTGTGGACCAGTTGCCATGGGACTGGAGCATTGAAAGACATGCTGAGGAATTATCTGTTAAATTGTTTGGAGAATTGTTTCTGTGAGTGTATGGACTGGGGTAAGGAGCGGAGCGGTGGTTCCTCAGAGATGAGTATCGCTCACAGCCATGAGGAGATGAATAGAGAGAGAGGTGCCCCGAACTGAGTGTGTGGATTGGGCGTACATAATGATCCACCATTANGAATGAGCCAAGTACCTAACTGAGAGAAATTTGAGTGCTGACTATTAATTCCCTCATCCCAGATGTCTTTATNATCATTTTCTTCTTTTGCATCAAGAAATGCTTTGGGCAAATGGGGTGGTGCTTGATTTTTAAGTGCTGGTAATCTCTTCATTTCTTGGTATGCGGGTCCCTGGCTATGAAACGGGGTTCTCCAGGGGAAAAAGAAATGGGGG
Full Trace Sequence: CGGGTAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATTGATGGTGGTGCAACTGGTGTCCATGCTGATGAAAGCCTGGAATGTGCAGTGACATCATACTGGTTTTCTGCTATTTCTGTTTGTGCTCCATGTTCATACAATGGGGATCCTGTGGTTGGTGAGGGCACAGCATGTGAAAGAGATGAGTAATGAGGTGTAGAGCCACGTAGGTACTGGGGACTTGTTCCATTACTTATTCCTCCAGACTGAGACACTGGTGTGATGGTACTGTTACTTACAGACCACAAAGAAGTGTACTGACTTGAGGTAGGTGGTGTTCCTGTGCTGTGACTCATTGGCAACATCCCTGTGTGTGCTGGCATTTGAAGTGTGGACCAGTTGCCATGGGACTGGAGCATTGAAAGACATGCTGAGGAATTATCTGTTAAATTGTTTGGAGAATTGTTTCTGTGAGTGTATGGACTGGGGTAAGGAGCGGAGCGGTGGTTCCTCAGAGATGAGTATCGCTCACAGCCATGAGGAGATGAATAGAGAGAGAGGTGCCCCGAACTGAGTGTGTGGATTGGGCGTACATAATGATCCACCATTANGAATGAGCCAAGTACCTAACTGAGAGAAATTTGAGTGCTGACTATTAATTCCCTCATCCCAGATGTCTTTATNATCATTTTCTTCTTTTGCATCAAGAAATGCTTTGGGCAAATGGGGTGGTGCTTGATTTTTAAGTGCTGGTAATCTCTTCATTTCTTGGTATGCGGGTCCCTGGCTATGAAACGGGGTTCTCCAGGGGAAAAAGAAATGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATTGATGGTGGTGCAACT