ORFeome > tada3 ORF1 – XORFeome v1.0

tada3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tada3
Gene ID: 6255203
Gene Page ID: 969839
ORF Xenbase ID: 17299821

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056843
Original XGC clone length: 1299

Human orthology & disease relationships

NCBI Entrez ID: 10474
Ensembl gene IDs: ENSG00000171148
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 133239,151623,211980,260500,275355

Library Location

Plate ID: GDExl11002
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ839301
dbEST ID: 79657003
Trimmed Sequence: ATGAGCGAGTTAAAGGATTGTCCTCTCCAGTTCCACGACTTCAAGTCTGTGGATCATATTAAGTTGTGCCCCAGATACACCGCAGTTCTGTCCCGCTCAGAGGATGACGGAATCGGCATTGAGGAGCTCGATACTCTTCAGCTGGAGCTGGAAACCTTGCTGTCCTCTGCGAGCCGGAGACTCCGTGTGCTGGAAGCGGAGACCCAGATTCTCACAGACTGGCAGGATAAAAAGGGTGATCGGCGGTTCCTAAAACTGGGCAAGGAACATGAGCTTGGCACACCCATCAAACACAGCAAGCCCAAGAAACAGAAGCTGGACGGGAAAGTTAGCCACGCGTCTGGACCTGGTCCCGGGAGGCCAAAGTCTAGAAACATGCAGCAAAAGATGCAGGAATATGAATTCACAGATGATCCTGTGGATGTGCCAAGAATTCCCAAAAATGATGCCCCGAACAGGTTTTGGGCCTCGGTGGAACCGTACTGTGCAGACATTACAAACGACGAGATTAAAGTGTTAGAGGATCTTCTGAAAACGCCCGAGGATGAAGCCGATTACTATAAGATTCCTCCACTGGGAGAACACTATTCGCAGCGGTGGGCACAGGAGGACCTTCTGGAAGAGCAGAAAGATGGCGCCCGGGCAGCTTTATCAGGAGACAAGAAAAAAAGCAATTCTGGGACCTCTGGCTGAACTGGATTCCAAAGAAGTGGACTCTTTGCTGAAGAAAATCTGACTCTCAGCCTGAACCAACCAAAAAGAAAGGGCTGGTCCATTTTGGGTCCCCCTTAAACCCACCCCCCC
Full Trace Sequence: CGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCGAGTTAAAGGATTGTCCTCTCCAGTTCCACGACTTCAAGTCTGTGGATCATATTAAGTTGTGCCCCAGATACACCGCAGTTCTGTCCCGCTCAGAGGATGACGGAATCGGCATTGAGGAGCTCGATACTCTTCAGCTGGAGCTGGAAACCTTGCTGTCCTCTGCGAGCCGGAGACTCCGTGTGCTGGAAGCGGAGACCCAGATTCTCACAGACTGGCAGGATAAAAAGGGTGATCGGCGGTTCCTAAAACTGGGCAAGGAACATGAGCTTGGCACACCCATCAAACACAGCAAGCCCAAGAAACAGAAGCTGGACGGGAAAGTTAGCCACGCGTCTGGACCTGGTCCCGGGAGGCCAAAGTCTAGAAACATGCAGCAAAAGATGCAGGAATATGAATTCACAGATGATCCTGTGGATGTGCCAAGAATTCCCAAAAATGATGCCCCGAACAGGTTTTGGGCCTCGGTGGAACCGTACTGTGCAGACATTACAAACGACGAGATTAAAGTGTTAGAGGATCTTCTGAAAACGCCCGAGGATGAAGCCGATTACTATAAGATTCCTCCACTGGGAGAACACTATTCGCAGCGGTGGGCACAGGAGGACCTTCTGGAAGAGCAGAAAGATGGCGCCCGGGCAGCTTTATCAGGAGACAAGAAAAAAAGCAATTCTGGGACCTCTGGCTGAACTGGATTCCAAAGAAGTGGACTCTTTGCTGAAGAAAATCTGACTCTCAGCCTGAACCAACCAAAAAGAAAGGGCTGGTCCATTTTGGGTCCCCCTTAAACCCACCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCGAGTTAAAGGATTGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ839300
dbEST ID: 79657002
Trimmed Sequence: ACCATCAAGCAGCTTTAAGATGCTCTCCCTTTCCTTAAGGGCTTTCCAGGCCTGGTCCTTTTCCTTCTTTGTTGGAGTCCTTTTCTTCTGCCGGGCAGCCATGATCTTCCGGAAAGCGTCCATAACCTCATTGTCAGCCATGCGGACTCTTTGTCGCAGCTCCTGCCTGTTCATTTCTTCCTTTGCAAGCCTGAGCAGTTCCTGTTTCTTGGCTCGGTTGTGAGCACTGAGAGCCTTCAGCTCCGCTTGCCTTTTGCGCAGCTCAGCTAAGACTTCATCCTCAGAATCATCAGCAGGGCGGTCGTCAGACTCCAGCAGCCCCTGGGCTATCAGCTCTTCTTTTACGCGGACCTCTAGTGACTTGGTATGGGGGGCACTGAAGGGTTTGTTCTGGCTGCGAGGAGAGGTACTTGCTCCATCTGTTCCAGATTCCTTTCCTGATATCTCCGGGATTGGGGAATCTTCTACAGGGGAAATAATGTTCTCCTCCACCAAAGCCTGCAGGAGGCGCTGTGTCAGGTGACCAAATGGACAGCCATCCTCTGGTTGGTCATGCTGAGAGTCAGATTTCTTCAGCAAAAAGTCCAAATCTTTTGGATCCAATTTCACCCAGAGGTCCCAGAATGCCTTTCTTCTTGTCTTCCTGATAAAGCTTCCCCTGGCGCCATCCTTCTGGCTCTTCCAAAAAGGTCCCCCTGTGGCCACCCCCTCCGAAAAAGGGTTTTCCCCCGGGGAAGAAATCCTAAAAATTAAACGCGGCCTTTCCTCC
Full Trace Sequence: CGGGAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCATCAAGCAGCTTTAAGATGCTCTCCCTTTCCTTAAGGGCTTTCCAGGCCTGGTCCTTTTCCTTCTTTGTTGGAGTCCTTTTCTTCTGCCGGGCAGCCATGATCTTCCGGAAAGCGTCCATAACCTCATTGTCAGCCATGCGGACTCTTTGTCGCAGCTCCTGCCTGTTCATTTCTTCCTTTGCAAGCCTGAGCAGTTCCTGTTTCTTGGCTCGGTTGTGAGCACTGAGAGCCTTCAGCTCCGCTTGCCTTTTGCGCAGCTCAGCTAAGACTTCATCCTCAGAATCATCAGCAGGGCGGTCGTCAGACTCCAGCAGCCCCTGGGCTATCAGCTCTTCTTTTACGCGGACCTCTAGTGACTTGGTATGGGGGGCACTGAAGGGTTTGTTCTGGCTGCGAGGAGAGGTACTTGCTCCATCTGTTCCAGATTCCTTTCCTGATATCTCCGGGATTGGGGAATCTTCTACAGGGGAAATAATGTTCTCCTCCACCAAAGCCTGCAGGAGGCGCTGTGTCAGGTGACCAAATGGACAGCCATCCTCTGGTTGGTCATGCTGAGAGTCAGATTTCTTCAGCAAAAAGTCCAAATCTTTTGGATCCAATTTCACCCAGAGGTCCCAGAATGCCTTTCTTCTTGTCTTCCTGATAAAGCTTCCCCTGGCGCCATCCTTCTGGCTCTTCCAAAAAGGTCCCCCTGTGGCCACCCCCTCCGAAAAAGGGTTTTCCCCCGGGGAAGAAATCCTAAAAATTAAACGCGGCCTTTCCTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCATCAAGCAGCTTTAAGATGC