ORFeome > taf11 ORF1 – XORFeome v1.0

taf11 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: taf11
Gene ID: 6255540
Gene Page ID: 491198
ORF Xenbase ID: 17299839

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC130172
Original XGC clone length: 549

Human orthology & disease relationships

NCBI Entrez ID: 6882
Ensembl gene IDs: ENSG00000064995
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 133239,151623,211980,214150,216400,260500,275355,601675,607136

Library Location

Plate ID: GDExl11090
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ838553
dbEST ID: 79656255
Trimmed Sequence: ATGCCCAGTGAAGGAGAAAAGGAAACGGATGAGAGCGTCTCAGAGCAACAAGTGAAAAGAGAGCATGAGGATGTTGAGGATGAGGTGAAGGTTGCAGAAAGCCCAGAGCATTCTGGTGTGACAGAGCCAGTAGAGACCTCTGATCTTGTGTCAGGCAGCAGAAAAATGAAGTTGGAAGCCAAGGAGCGAAGAGAGAAGAAGCAAAAAGTTGATGAGGATGAGATCCAGAAAATGCAAATATTGGTGTCATCATTTTCTGAGGAACAGCTAAATCGATATGAGATGTACAGGCGTTCTGCTTTCCCTAAAGCTGCTATTAAACGGCTAATTCAGAACATTACAGGCTGCTCAGTTTCCCAGAATGTTGTCATTGCAATGTCTGGCATTTCCAAAGTCTTTGTGGGTGAGGTTGTAGAAGAAGCTTTGGATGTATGTGAAAAGTGGGGGGATAATCCTCCATTACAACCCAGACACATGAGGGAAGCCCTCAGACGACTAAAGTCTCGGGGACAAATTCCAAACTCCAAGCACAAGAAGATAATGTTTTTGTCCACTTTCTTGGTACAGGTTGGCATTATTGGAAAGCATTGGCTTATCATTTGTTGCATCGAACAGGTCACTTATTCATCCAAATAAATTATTATTTTGCATCCCACCTGAAATCCCCTTAAGGGGAGTCGTATTAAAAAAAAAAAAAGAAGAAAAGGAGGAACTCAAAGGCGCGGGTCTCAAAAATTCTTAAATTATAAAAAAAAAAAAANAAGNAGNNNGNTGGGGAGGTTCTGCGCCAGGTGTGAGGGGTGAATACGATGGGGAAGGGGAAGGGA
Full Trace Sequence: CTCGAGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCAGTGAAGGAGAAAAGGAAACGGATGAGAGCGTCTCAGAGCAACAAGTGAAAAGAGAGCATGAGGATGTTGAGGATGAGGTGAAGGTTGCAGAAAGCCCAGAGCATTCTGGTGTGACAGAGCCAGTAGAGACCTCTGATCTTGTGTCAGGCAGCAGAAAAATGAAGTTGGAAGCCAAGGAGCGAAGAGAGAAGAAGCAAAAAGTTGATGAGGATGAGATCCAGAAAATGCAAATATTGGTGTCATCATTTTCTGAGGAACAGCTAAATCGATATGAGATGTACAGGCGTTCTGCTTTCCCTAAAGCTGCTATTAAACGGCTAATTCAGAACATTACAGGCTGCTCAGTTTCCCAGAATGTTGTCATTGCAATGTCTGGCATTTCCAAAGTCTTTGTGGGTGAGGTTGTAGAAGAAGCTTTGGATGTATGTGAAAAGTGGGGGGATAATCCTCCATTACAACCCAGACACATGAGGGAAGCCCTCAGACGACTAAAGTCTCGGGGACAAATTCCAAACTCCAAGCACAAGAAGATAATGTTTTTGTCCACTTTCTTGGTACAGGTTGGCATTATTGGAAAGCATTGGCTTATCATTTGTTGCATCGAACAGGTCACTTATTCATCCAAATAAATTATTATTTTGCATCCCACCTGAAATCCCCTTAAGGGGAGTCGTATTAAAAAAAAAAAAAGAAGAAAAGGAGGAACTCAAAGGCGCGGGTCTCAAAAATTCTTAAATTATAAAAAAAAAAAAANAAGNAGNNNGNTGGGGAGGTTCTGCGCCAGGTGTGAGGGGTGAATACGATGGGGAAGGGGAAGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCAGTGAAGGAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838552
dbEST ID: 79656254
Trimmed Sequence: AAACATTATCTTCTTGTGCTTGGAGTTTGGAATTTGTCCCCGAGACTTTAGTCGTCTGAGGGCTTCCCTCATGTGTCTGGGTTGTAATGGAGGATTATCCCCCCACTTTTCACATACATCCNAAGCTTCTTCTACAACCTCACCCACAAAGACTTTGGAAATGCCAGACATTGCAATGACAACATTCTGGGAAACTGAGCAGCCTGTAATGTTCTGAATTAGCCGTTTAATAGCAGCTTTAGGGAAAGCAGAACGCCTGTACATCTCATATCGATTTAGCTGTTCCTCAGAAAATGATGACACCAATATTTGCATTTTCTGGATCTCATCCTCATCAACTTTTTGCTTCTTCTCTCTTCGCTCCTTGGCTTCCGACTTCATTTTTCTGCTGCCTGACGCAAGATCAAAGGTCTCTACTGGCTCTGTCACACCAGAATGCGCTGGGCTTTCTGCAACCTTCACCTCATCCTCAACATCCTCATGCTCTCTTTTCACTTGTTGCTCTGAGACGCTCTCGTCCCTTTCCGTTTCACCTTTCCTGGTCGTGGGGGCCGGGTGTTTTTGACAGGGTGGCATTATGAGAAAGCATTACTAGTCAATTTTTTTCAGCCAACAGGATAACAAAAAAATAAAAAAAAAAAAAAAAAATATAGAGGAACGGGCGTTCGAACTGGCCCTCGTTTTAAAAAAATTTTTGAACGGGGGGGGAGGGGGGGGGNNNNNNTANNNNGNNNNNGNNNNGGNNNNGANGGGGGGGGNGAGGAGGGNGNGN
Full Trace Sequence: AAACAGGCTATTGACGCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAACATTATCTTCTTGTGCTTGGAGTTTGGAATTTGTCCCCGAGACTTTAGTCGTCTGAGGGCTTCCCTCATGTGTCTGGGTTGTAATGGAGGATTATCCCCCCACTTTTCACATACATCCNAAGCTTCTTCTACAACCTCACCCACAAAGACTTTGGAAATGCCAGACATTGCAATGACAACATTCTGGGAAACTGAGCAGCCTGTAATGTTCTGAATTAGCCGTTTAATAGCAGCTTTAGGGAAAGCAGAACGCCTGTACATCTCATATCGATTTAGCTGTTCCTCAGAAAATGATGACACCAATATTTGCATTTTCTGGATCTCATCCTCATCAACTTTTTGCTTCTTCTCTCTTCGCTCCTTGGCTTCCGACTTCATTTTTCTGCTGCCTGACGCAAGATCAAAGGTCTCTACTGGCTCTGTCACACCAGAATGCGCTGGGCTTTCTGCAACCTTCACCTCATCCTCAACATCCTCATGCTCTCTTTTCACTTGTTGCTCTGAGACGCTCTCGTCCCTTTCCGTTTCACCTTTCCTGGTCGTGGGGGCCGGGTGTTTTTGACAGGGTGGCATTATGAGAAAGCATTACTAGTCAATTTTTTTCAGCCAACAGGATAACAAAAAAATAAAAAAAAAAAAAAAAAATATAGAGGAACGGGCGTTCGAACTGGCCCTCGTTTTAAAAAAATTTTTGAACGGGGGGGGAGGGGGGGGGNNNNNNTANNNNGNNNNNGNNNNGGNNNNGANGGGGGGGGNGAGGAGGGNGNGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAACATTATCTTCTTGTGCTTGGA