ORFeome > taf4 ORF1 – XORFeome v1.0

taf4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: taf4
Gene ID: 865788
Gene Page ID: 488489
ORF Xenbase ID: 17299875

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130109
Original XGC clone length: 3051

Human orthology & disease relationships

NCBI Entrez ID: 6874
Ensembl gene IDs: ENSG00000130699
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 137750,137760,145000,151623,211980,214150,216400,275355,601675,606657,607136,608354,608355

Library Location

Plate ID: GDExl11084
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ837612
dbEST ID: 79655314
Trimmed Sequence: ATGGCGGCGGGTTCGGATCTGCTGGATGAGGTTTTCTTCAACACGGACGTGGACGATAAAGTGGTCAGCGAACTGGTGGGATCCCTGGAGTCTCAACTGGCCGCCGCGGCCCACCAGCACCATCATCATCACCAGCAGCAGCCCCCCGCCGAGGCCCGTAGCCAGGCCCTGGCTAACCATGTCACCAGCCCGGGGGTAGGGGCAGCCAGTGCGGGGGGACAGCCTGAGGCCAAGATAGGGCTCTCCCCGGAGGTGCCTAAGACGGGAGCCGCTGTCCCTGGAGTTCAAGGAGGTGTCATTAACAGCCGACCACAAACCACAGCCCAGCCTGACGGGACTCAGTCTGCTATACCTGAAGCACCAGGAGTTCTTAGCCAGGCTAAAGCTGGGGTTCTGGGCACCATGGCATCCACTCTGCCCAACCACAGTTCAGGTAATGGTAAAAACGCCACCCTACAGACCATGAATGGGAGTAATGTTGTGATTAATTCACATGGACCCGGGGGTCATGGGACCCCTTATCANGGGAACAGCAACCTGATGAACAATGGACCCGCTCCTGTCACTAANGGTGGAGTGAACCCAGGAGCTAACACCGTTATTCAGACTTTTCTTGGGACTACTAATGTGGCATCCTCTGTCCTCTCTTCCTCATCCACATCAACCGCTGGAACAGCTGGGCACAAACTGGGCATGGGGGGGTGGTACCCACGATTGTACCATTTGGTTAAAACCTCTTTTTTCACCCGGGGTGTGCCCCTGCCGGCTTCAGAATG
Full Trace Sequence: GGCGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGGGTTCGGATCTGCTGGATGAGGTTTTCTTCAACACGGACGTGGACGATAAAGTGGTCAGCGAACTGGTGGGATCCCTGGAGTCTCAACTGGCCGCCGCGGCCCACCAGCACCATCATCATCACCAGCAGCAGCCCCCCGCCGAGGCCCGTAGCCAGGCCCTGGCTAACCATGTCACCAGCCCGGGGGTAGGGGCAGCCAGTGCGGGGGGACAGCCTGAGGCCAAGATAGGGCTCTCCCCGGAGGTGCCTAAGACGGGAGCCGCTGTCCCTGGAGTTCAAGGAGGTGTCATTAACAGCCGACCACAAACCACAGCCCAGCCTGACGGGACTCAGTCTGCTATACCTGAAGCACCAGGAGTTCTTAGCCAGGCTAAAGCTGGGGTTCTGGGCACCATGGCATCCACTCTGCCCAACCACAGTTCAGGTAATGGTAAAAACGCCACCCTACAGACCATGAATGGGAGTAATGTTGTGATTAATTCACATGGACCCGGGGGTCATGGGACCCCTTATCANGGGAACAGCAACCTGATGAACAATGGACCCGCTCCTGTCACTAANGGTGGAGTGAACCCAGGAGCTAACACCGTTATTCAGACTTTTCTTGGGACTACTAATGTGGCATCCTCTGTCCTCTCTTCCTCATCCACATCAACCGCTGGAACAGCTGGGCACAAACTGGGCATGGGGGGGTGGTACCCACGATTGTACCATTTGGTTAAAACCTCTTTTTTCACCCGGGGTGTGCCCCTGCCGGCTTCAGAATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGGGTTCGGAT

Sequences - 3ʹ (reverse) EST

Accession: JZ837611
dbEST ID: 79655313
Trimmed Sequence: CTTAAGGAATGCTTTGTATAGCAATAGTGAATGGCTTGTCTCTCGTTCACTCTCCAAACATAATATGAGGTCCCTGAGATTGACTCGCGTTATCCTTTGTCTTGTAAACTGTCGGCTGCTCCCTCCTGCAGAACTGCTGGCCGTGGCTGTACTTGTGCTGGACGACTCTGAACCAGAACCAGGGCCCGGTGATTCGACTTTCCTCTTCTTTCGAGGGCCAATAGCTGCTAGCGCTGTTAAATTAGCATCTCTCTGCCTCATTTGTGCCAGTTCCTGCTGTTGCATCTCTTTAGCCTTCTGTTTTAGCCGTAATTGTTCCGGATCCTCCTGCCTTGACCGAGACTTAGCTGCCCGCATAAGAATCTCTCGCTCCTGCTCATCTTTCCTCTGCTTCTCGATATGATCAAGCTGCTCGAAGAATTTGAGCTGCGTCCGTACGTCGCTGGTTTGTTCATACCTATCGTCGTCCTTGTGTGAAATATTCTTTTGCTGCGCTGTTTCAGAGATTTTTTCTACAATGCTTTGTAGCCGCTGTTGTGTTGCGTGGGAGACATAACTGACAACGTCCTGATGGATTTCTGTGATTCCGTGCTTTTTACCTATTTCCAATATCCTCCTCTGTAACAATGCAGGCAGAAGAAACGTCTCGTCTTTTGCAGAACCCGTTTACGTGCCCACCAACTCCCAAAATTCTTGCCCATTAACTTTGCACTTTTCTTCCAAAAAAGGTTCCAACCCGGCC
Full Trace Sequence: GGGAAACTGCTAATGACCATGTAATACGACTCACTATANGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTAAGGAATGCTTTGTATAGCAATAGTGAATGGCTTGTCTCTCGTTCACTCTCCAAACATAATATGAGGTCCCTGAGATTGACTCGCGTTATCCTTTGTCTTGTAAACTGTCGGCTGCTCCCTCCTGCAGAACTGCTGGCCGTGGCTGTACTTGTGCTGGACGACTCTGAACCAGAACCAGGGCCCGGTGATTCGACTTTCCTCTTCTTTCGAGGGCCAATAGCTGCTAGCGCTGTTAAATTAGCATCTCTCTGCCTCATTTGTGCCAGTTCCTGCTGTTGCATCTCTTTAGCCTTCTGTTTTAGCCGTAATTGTTCCGGATCCTCCTGCCTTGACCGAGACTTAGCTGCCCGCATAAGAATCTCTCGCTCCTGCTCATCTTTCCTCTGCTTCTCGATATGATCAAGCTGCTCGAAGAATTTGAGCTGCGTCCGTACGTCGCTGGTTTGTTCATACCTATCGTCGTCCTTGTGTGAAATATTCTTTTGCTGCGCTGTTTCAGAGATTTTTTCTACAATGCTTTGTAGCCGCTGTTGTGTTGCGTGGGAGACATAACTGACAACGTCCTGATGGATTTCTGTGATTCCGTGCTTTTTACCTATTTCCAATATCCTCCTCTGTAACAATGCAGGCAGAAGAAACGTCTCGTCTTTTGCAGAACCCGTTTACGTGCCCACCAACTCCCAAAATTCTTGCCCATTAACTTTGCACTTTTCTTCCAAAAAAGGTTCCAACCCGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTAAGGAATGCTTTGTATAGCAA